Transcript asmbl_25667

Sequence
Transcript Sequence for observation asmbl_25667 of TGE0004556:
GGAAGATGTTGGCTATTTGGCGATAGAAGTGGTGAAAACTGACCTCACACCGGTAGACGAGCACTACGGGACCTGATCCTCTTGCTGCACGGGCAGCCGGCCCCCACTGAGCATGTTGGGAAGCCATGGAGTCCACTGGAAAACACTAGTCTGATCTTGGAAGTGGCTGATTGTGGCAGGATGTGTCGACGATGATGATGGCCAGAAAGCAAGATGTCCGTGTTCCCACCTACAACATCAGCGTGGTGGGGCTGTCTGGGACCGAGAAGGAGAAGGGCCAGTGCGGCATCGGGAAGTCCTGTCTGTGCAACCGCTTCGTGCGCCCGAGCGCCGACGAGTTCCACTTGGACCACACCTCTGTCCTCAGCACCAGTGACTTTGGCGGGCGGGTGGTCAATAATGACCACTTCCTCTACTGGGGAGAAGTCAGCCGATCCCTGGAGGATTGCGTGGAATGTAAGATGCACATCGTGGAGCAGACTGAGTTCATTGACGATCAGACCTTTCAGCCGCATCGAAGCACGGCCCTGCAGCCCTACATCAAGAGAGCTGCCGCGACCAAGCTCGCGTCGGCTGAGAAACTCATGTACTTTTGCACTGACCAGCTGGGGCTGGAGCAGGACTTTGAGCAGAAACAAATGCCAGATGGAAAGCTGCTGATCGATGGTTTTCTTCTCGGCATTGACGTTAGCAGGGGCATGAATAGGAACTTTGATGACCAGCTCAAGTTTGTCTCAAATCTCTACAATCAGCTTGCAAAAACAAAAAAGCCCATCGTGGTGGTCCTGACTAAGTGTGATGAGGGCGTCGAGCGGTACATTAGAGATGCACATACTTTTGCCTTAAGCAAAAAGAACCTCCAGGTTGTGGAGACCTCAGCAAGATCCAACGTCAACGTGGACTTGGCTTTCAGCACCTTAGTGCAACTCATTGATAAAAGTCGGGGAAAGACGAAAATCATCCCTTACTTTGAAGCTCTCAAGCAGCAGAGTCAGCAGATAGCTACGGCAAAAGACAAGTACGAGTGGCTGGTGAGTCGCATTGTGAAAAACCACAACGAGAACTGGCTGAGTGTCAGCCGAAAGATGCAGGCCTCCCCTGAGTACCAGGACTACGTCTACCTGGAAGGGACCCAGAAAGCCAAGAAGCTGTTTCTCCAGCACATCCACCGCCTCAAACACGAGCACATCGAGCGCAGGAGGAAGCTGTACCTGGCAGCTCTGCCGTTGGCTTTCGAAGCTCTTATACCCAATCTGGATGAAATAGACCACCTGAGCTGCGGAAAAGCCAAAAAGCTCTTGGAGACCAAGCCGGAGTTCCTGAAGTGGTTCGTCGTGCTCGAGGAGACCCCGTGGGATGCCACCAGCCACATCGACAACATGGACAACGAGCGGATTCCCTTCGACTTGATGGACACTGTCCCCGCAGAGCAGCTGTATGAGGCCCACTTAGAGAAGCTGCGGAACGAGAGGAAAAGAGCTGAGATGAGGAGGGCGTTTAAAGAAAACCTGGAGACCTCGCCTTTCATAACTCCTGGCAAGCCCTGGGAAGAGGCCCGCAGTTTCATCATGAATGAAGATTTCTACCAGTGGCTGGAAGAATCTGTATACATGGATATCTATGGCAAACACCAAAAGCAAATTATAGACAGGGCAAAGGAGGAGTTTCAGGAGCTGCTTTTGGAATATTCAGAATTGTTCTATGAGCTGGAGCTGGACGCTAAGCCCAGCAAGGAGAAGATGGGTGTTATTCAGGATGTCCTGGGGGAAGAACAGCGGTTTAAAGCGCTGCAGAAGCTCCAGGCGGAGCGCGATGCCCTCATCCTGAAGCACATCCACTTCGTGTACCACCCAACAAAGGAGACGTGCCCCAGCTGCCCAGCCTGCGTGGACGCTAAGATCGAGCACTTGGTTAGTTCCCGGTTTATCCGACCATCTGACCGGAATCAGAAAAATTCACTCTCTGACCCCAACATCGATAGAATCAACTTGGTTATCCTGGGCAAAGATGGCCTTGCCCGAGAGTTGGCCAATGAGATTCGAGCTCTTTGTACAAACGATGACAAGTACGTGATAGATGGTAAAATGTATGAGCTTTCCCTGAGGCCGATAGAAGGGAACGTCAGGCTTCCCGTGAACTCTTTCCAGACGCCCACGTTTCAGCCCCACGGATGTCTCTGCCTCTACAATTCGAAGGAGTCGCTGTCCTACGTGGTGGAGAGCATCGAGAAGAGTAGAGAGTCCACACTCGGCAGGCGAGATAATCACTTAGTCCATCTCCCCCTGACGCTAATTCTGGTGAACAAGAGAGGAGACACCAGCGGAGAGACGCTGCATAGCTTAATCCAGCAAGGCCAGCAGATCGCCAGCAAACTCCAGTGTGTCTTCCTGGACCCTGCCTCTGCCGGCATCGGTTATGGACGCAACATTAACGAAAAGCAGATCAGTCAAGTGTTGAAAGGACTCCTGGACTCTAAGCGTAACTTAAACCTGGTCAGTTCTACCGCTAGCATCAAAGATCTGGCTGACGTTGACCTGCGAATTGTCATGTGTCTGATGTGCGGAGACCCTTTTAGTGCAGACGACATCCTCTTTCCCGTCCTTCAGTCCCAAACCTGTAAATCTTCCCATTGCGGAAGCAACAACTCTGTTTTACTTGAACTACCAATCGGGCTACACAAGAAGCGCATTGAACTGTCTATTCTTTCATACCATTCCTCGTTTAGCATCAGAAAAAGCCGGTTGGTCCATGGGTACATTGTTTTTTATTCAGCCAAACGTAAGGCCTCCTTGGCTATGTTACGTGCCTTTCTTTGTGAAGTGCAGGATATTGTCCCCATTCAGCTGGTCGCACTCACTGACGGCGCTGTAGATGTCCTGGACAATGACTTAAGTCGGGAGCAGCTGACCGAGGGGGAGGAGATCGCTCAAGAGATAGATGGCAGGTTCACAAGCATCCCCTGCAGCCAAGCCCAGCACAAACTCGAGATCTTCCACCCATTTTTTAAGGATGTGGTGGAGAAAAAGAACATAATCGAGGCGACGCACATGTACGATAACGCTGCCGAGGCCTGCAGCACCACGGAGGAGGTGTTCAACTCCCCCCGGGCGGGCTCTCCGCTCTGCAACTCCAACCTGCAGGATTCGGAAGAGGACATCGAGCCCCCTTCCTACAGCCTGTTTCGAGAAGACACGTCGCTGCCCTCTCTGTCCAAAGACCATTCCAAGCTGTGTATGGAGCTGGAGGGGAACGATGGGCTGTCTTTCATCATGAGCAATTTTGAGAGTAAACTCAACAACAAAGTACCTCCGCCAGTCAAACCAAAGCCTCCTCTCCATTTTGATATTACAAAGGGGGATCTGTCTTACTTAGATCAAGGCCACAGAGATGGGCAGAGGAAGTCTGTGTCTTCTAGTACCTGGCTACCTCCGGACGCGTTCGATCCTTCCGATTACGCCGAACCCATGGATGCAGTGGCCAAGCCGAGAAATGAGGAAGAAAACATATACTCGGTGCCCCACGACAGCACCCAAGGCAAGATCATCACCATCCGGAACATCAACAAAGCCCAGTCCAACGGCAGTGGGAACGGTTCCGACAGTGAGATGGACACCAGCTCCCTAGAGCGAGGCCGCAAGGTATCCATCGTGAGCAAGCCAGTGCTGTACAGGACGAGATGCAGCCGGCTGGGGAGGTTCGCTAGCTACCGAACCAGCTTCAGCGTGGGGAGCGATGATGAGCTGGGGCCCATCCGGAAGAAAGAGGAGGATCAGGCGTCCCAAGGTTATAAAGGGGACAATGCCGTCATCCCGTATGAGACAGACGAAGACCCGAGGAGGAGGAACATCCTGCGCAGTCTGCGAAGGAACACCAAGAAACCAAAGCCCAAACCCCGGCCGTCCATCACGAAGGCAACCTGGGAGAGTAACTATTTTGGGGTCCCCTTAACGACCGTCGTGACTCCAGAGAAGCCAATCCCTATTTTTATTGAGAGGTGTATTGAGTACATTGAAGCCACAGGACTGAGCACCGAAGGCATCTACCGCGTCAGCGGGAACAAGTCGGAGATGGAGAGCCTGCAGAGGCAGTTCGATCAAGACCACAACCTGGACCTGGCGGAGAAGGACTTCACAGTGAACACGGTGGCTGGGGCCATGAAGAGCTTTTTCTCGGAACTGCCTGACCCCCTGGTCCCGTACAGCATGCAGACTGACCTGGTGGAGGCTCACAAAATCAACGACCGAGAGCAGAAGTTGCACGCCCTTAAGGAAGTACTCAAGAAATTTCCGAAGGAAAACCACGAAGTCTTCAAATATGTCATCTCGCACCTGAACAAAGTCAGCCACAACAACAAGGTGAACCTCATGACCAGTGAGAACCTCTCCATCTGCTTCTGGCCCACCCTGATGCGGCCGGACTTCAGCACCATGGACGCGCTCACGGCCACGCGCACCTACCAGACGATCATTGAGCTCTTCATCCAGCAGTGCCCCTTCTTCTTCTACAACCGGCCCATCAGCGAGCCCCCCGGCGCCACGCCCAGCTCCCCCTCCGCCCTGGCCTCCAGCGTGCCCTTCCTCACCTCCACACCGGTCACCGGTCAGCCGTCGCCCCCACAGTCGCCTCCACCCACCCCTCAGTCCCCGATGCAGCCCCTGCTCCCCTCCCAGCTTCAAGCCGAGCACACGCTGTGAGTCACCAAGGCCTGGGGCAAAAAGAGGCTCGATTTTCTCAGTCGGGGTGGCGTTTGGTCTTGAACACAACCAGGTCCACTGGGGCAGGGGTGGGGAGGCTGTCCCCTCCCCCTCTGTCACCTTCTCAAGATCTCAGCTGCAGCACCAGCCAGCGTCCACCATAGGCTGGGCCCGCGGCGCCCCGAGCCCAGCGCCGCAGACCTGGGGCTGACTGCGGGCAGCGGCTGGGGGCCCTGCCCTTGGACACGGACCCCTTCGAAGACTGACTGGCCAGGCGGCGGCCCCGGTGGCCGTCCACATGCTCGCTGTTCCGGGACTGCCTGCCCACGCACACCAGCTTCGGCGTCACCCACTGCCTGACAGAGCCCTGGCCTTTGCCAGGGGGAGGAGGTGGTTTTGATTCGGGCCACCCCTGGCAACCTCCGAGGAGACACTTCTCATCTGGCTCACCTGTCTCCCTACCTTCCACATCTGTTCCCACCCCCGTCGGCGGGGCGCCTGTCCAGCAGCCTCCTGGGGAACAGAGGCCACGGCGCTGCCGCCCCAAGGCACAGTGCCGAGGGCGTCTGCCCGGCCGCCCAGAACAGCTGGAGGGAGCTTTGTGCCTGGACCGAGAGAGTGTGACTCGTCCCTCCAGCCCCCGTGCTCCCTGTCCGCTGCATAGGCTTCGGGGACAGTTCCCTTCATGACAGAGGGACACTGGGAGAAAAGGAGGAAAACCTGTCCAGTAACTTGGAAAAACAAAAAGGAAGAAACTACAGACCTCAAGACTCAGCTCCCCCGCTTCTCAGGCCGACGGGCGCAAGGGGGCCCTGGTCTTTGTGACAGCAAAACCAGGAGGCCTGGCGGGCGGCTGCCTGAGAACTAGTTGGGGGTCCCACTCACGTCCTGTTATCAGGTCTGTGTTCCCCAAGAAGAGACGATTCGAGCCCTCGGTGGGTGGAGCTGGGGATTCGAGCAGACCAGCCTGGCACCTGGTCTGCCCTGGAACACTACAGGCTGTGGGGACACTGGGGGGAGGAGGACTGGAGTGGGGCCAGCTCAGGGCGCACTGGGGTTTCGTTTAGTGTGCTTGGTGTTGAAGCGGAATCGTTTCATTCTGGGGCACACTGTGCCACCAGCAGGGTGTGTGCGGGAAGAGGGCGGGGTAGGGAACTGAAGCACTGTGTCCTGCTGGTGTCCGCAGGGGCCATCCTTCATGCTCCCCAGGCCAGGAGATCCCAGAGGAGCCACATGCACAGAGGCCACCAGAGTCACAACACCTGCCTGTCTCACCCCACCCCCCTCCTGTGGCCTTGCCCACCCTTTCTGAGAAATGGCCTCCCCTCAGCTTCCTGGCCTTTCCACTGGCCCCTGGGAGAACCCTTCCCACGCCCCAGTACACACAGCAACCTGCTAAGGCTGCTACAGACCTTGGCTGCCCCCTACCCCTGGTGGCCGGGCTGTGGCCGCTGCAGTGGAGAAGCCTGACACTACGGTGCCCAGGGTGCAGGGTGTGGGGTGGAGGGCCCGCCCACCACACTGACCTCTGGGTCTCTGCACTTTAAGAAGTAGCACCTGGGTGTGTTTGAGGATGCCCTGGTCACCTCAGCTGGGTGGCCTGACAAATTAAGAGATGCCCCGAGGACTGTCCAGGTACCCCTAGCCCCAGACGCTGCCGGCTGGCTGTAGAGAGTGGGGCAGCCCTCGGCTCACGGGCTCCTTCCTCTGGATAAGCTGGATCCTTACCGTTCCTAGTTCGCGTACGGCAAAATAAGGTGCTTGGAAAAACTAAATTATCCCTGCAAGTTTTACCCTCCTTTTCAGGAACCCAAGTCAAAAAACACACCCGAGGTACATGACCGTTTTATGTAAACGTTGGGTGACGAGCGTTTCTCTGGTGGAGCTGTGCTTGATGGTTTAGGTCAGGGTGGGCTGCAGGGTGACGTTCTTGTTCAGTTTTGACAGAGGTTGGCAGACCCCCAGGCAGGAGAGGAAGTCGGTCCACTGAATTAATTTGTCCCTCGTTCTCACCTGCTTCGAGGCACTGCGTTTGAGTTGAAAGGGTGCCATGGGGGTGACCTGGGGCCACTGTCCTGGTGCGAACTGAAATAGCAGTATCCCAGTTCCCTCCCGCTGCCCAGGCTGCACTGCCACCCCCTCGGTGCTGGCGCCCTGGCCACAGCCCCACCCCGCTTGCAGCCTGGGCTCTGCACCAGGAGCTCAGAAGCCCCCAACAGGCCTGCCTGCCCACGGCACCCCACCCTGAGATGCAGCGTGTACGCGGCAGGGGGTTCTGGGCGTGTGGGGAGGAGCAGCAGTGCTCGGCGTCCTCCCCAGATAGAGGTTGCCTCCGGTCCCGCAGCGCACCCTGGCGGCCAGCTGGAGCAGCCATGGGCCCCCCTCACCTTCCCGTGTCCTGCCAAGGTTTTCGAGGTGCAGGCGGGGGGACCAGCAGCTCCCGTCCAGCCAGAGCTGCAGTGGGCAGGCGGCTTCGGGGTTCCTCTCGTTTCTGCTGCTTCCTCACGGACTCCGCTGCTGCTTTCAGCTGGCCCAGGCTAGGGGACGTGTCTTGGTCATTCTGAGTTGGCATCACCACTGGTAGTGCTGGGCCCCAGGTGTCCGCTTCCACTCGGGGGTCGGCGTTCAGACGAAGTGGGCGCTTGGGTGGAGGGCCACGAGAGCTGGGGCTCGCGTGGGACGCTTCCTTAAACACATGCTCCCCACGGCTCGAAGCTAAGAGCGGAGCGAGCACGAGCCGGCCTTGGCCAGGGGGCCGGCAGGGCGTGGCGGGCAGGGCTCTCCCCGTCTGGTGGTCTGTCTGGGTCCACGAGAGAGTAGGTGCCACGACAGCCATTGGCTGTAAGCTGAAGGCCAGTCCTGCCCTGTGGCACTGGTGCCGTGGAGGGCAGGGGCTGGGGTGGCTCGCAGGGTCGCCCTGAACCCCTGGCCGTGTCGGGCGTCACAGCATCCTGACGTGAGGGGCACGGAGAGAACTGGGCGGCACGGTCTCTGTGAGCCCCACCCCCGCTGCCGCCGTGGTTCCTCCTGTGTGGCAGGAAGTCTGCCGCCGGGTGATTCTTCCAGAGCAGGCGAAGTGAGCCCTGGTGGCCATGGTGGTTCCTCGCAGCAGCGCGCTGCCCAGAGGGCTCAGGAGCGTGCGCCTTCCCCGTCCGTGTTCCTGGCGCGTGGGGGGTGAACAAGGGTGCCCCAGCCTCGGCCCTGAGATTTGAAAACGAGCTGCAGCGTTAGTGATCTGAAGTCGCCTCCCGCACCCCATCCCTCCCGTGAGAATACTGCTTTGAGGGGTCTGCTAGAGCAGGGGTCCCCAACCCCCAAACTGTGGACCGGTACCGGTCTGTGTCCTGGTAGGAACTGGGCCGCCCAGCAGGAGGGGAGCGGCGGACGGGCGAGCGAGTCGTCGTCCGTGTCCGCAGCTGCATCCCAGCGCCAGCATCGCCGCCTCAGCTCCCTCCCATCAGCGAGCATTGGATTCTCATGCAAGCACTGGTCCCTGATGCCACAAAGGTGAGGACCACTGCACTAGAAAAAGAAGTGGGCAGTGGCCGGGAAGTGTCGGCCCCCAGCCGCCGAGGGCTCTGGTCAGCCGGCCACTGCGTTTCCCAGGGGAAGCAGTGCCAGGACTTGGGCGAGTTGCTGGGGACCAGCTTCCTGTGCTCCACCTTCCTCGTGGGTCATGGGTGTAGCATGCCCTGGGGCACGGGAACGGGCCTGAAGGGCAAAGCCTTTGCCTCGCCTCCGGAGACAGGCACAGCGCTCATTCTGCAGACGGGGCCGTCACCCTCACTCCTATCGCTTGGCAGGTTCAAGCCACTCTTTTGCACTTAGGTGGAAGGACAGACTGAGTCACGTGTGCCAGAAACCTAAGTCCGGTCTGGGACTGTGCTGGGGACGGCAGCAGGGAGGGCGTGGTGTGCAGGGAAAGGCCGTTCTCTCCCAAGGTCTGGGCGTCCCCCGGGCTGTGCCTGTGTCGCTGTCTTAGATGGGAAGGACCCTTCCCTCGGGGAGCCGCCCACCTGTGGCCCCCCGGGGGTCAGAGGTGGCCACCCCTCTGCTGCCAACGCCGCCAGCCCACACGGCCGTGAGGTCACACTGTCAGTGTCGTGAGACGGGGCATAAGTTATTGTTTGCATAAAAAAGAATCATGTTCCCTGTGTACATTACAAAAAAGGAAATGTCTGAACCGTATGGGAATAAAACTTGTTTGAAAATTTGGAATAGTGCTGCTGCCAGCTTATTTTTCTGGTACTTGTATTTTCACATGTTAAATGATCTTTATATATGTTGAATTAACAAATATTTTGAGTTTCCTGAGGAAAAAAAAAACATTAATGGTATTGAAATGTGTTAGTAGTCTGGCCACGTGCCCAAAATTCTGTTTTGCAGCAAAAGTGGAGAACTGTTTGTGAAGAAAGTTAACAGTTGCTTCTTTGTGTTTTAGGGGCTTAACCAGGACACGCTCTAGGTGGTGGTAGGAATGTTTGCTTAATTTCCAGACTCTTTTTCTTTGAACATGTCGTGGGTACCTTGAGGCTCCAACCTGGCTAGTGCATGGTCAGCCATCAACTAAGGCTGAGGCATCTCTGACCGAGGTGTTCTACGTTTGGTTTTGTTTTTTAAAATCATGTATTTGCTACAAAGTATTGTACTTGTCTCAATGGGAATGGTGTAAAAAACTGAAAAGGCCTTATGTGATATGTATCATAGTCAATAAATCCGTCTTGT