Transcript asmbl_24820

Sequence
Transcript Sequence for observation asmbl_24820 of TGE0004512:
CCGGGCGGGTCAGAGAGCGCAGCGCGGCGGCAGCAGGAGCCGAGTAGCGTGCAGAGCCGGTCATGGGCAAGTCAGCTTCCAAGCAGTTTAACAGTGAGGTCCTGAAGGCCCACAACGAGTACCGGCAGCAGCATGGCGTTCCTCCACTGAAGCTCTGCAAGAAGCTCAACCAGGAGGCCCAGCAGTATTCGGAGGCCCTGGCCAGCACGAGGATCCTCAAGCACAGCCCAGAGTCCAGTCGTGGCCAGTGCGGAGAGAACCTAGCTTGGGCATCCTACGATCAGACAGGAAAGGAGGTGGCTGATAGATGGTACAGTGAAATCAAGAACTACAACTTCCAGCAGCCTGGCTTCAACTCTGGGACTGGACACTTCACGGCCATGGTGTGGAAGAACACAAAGAAGATGGGAGTGGGGAAGGCATCTGCAAGTGATGGGTCCTCCTTTGTGGTGGCCAGATACTTCCCAGCAGGGAATGTTGTTAACCAGGGCTTCTTTGAAGAAAATGTGCTGCCTCCAAAGAAATAACTTGTCAAACATAATGGGAAGGTGGCAGACTTAAGAACGTGGTATGAAGTACCTAGAAGAACATTAGCTGTGTGTTTGTCCTTGTGGGTGTACATGCTTGTGTGTGATGCATGTGTGCATCTCTTGCACACATACTCGGATATACAGTTCTGTATGAACTCATTCTTGTCAAAAGAATGAGCATATGAAGGCTTTACTCTGATAGTTACCTAGACCACAATTATTTGGACTTTGGGGGCAAAATCAATTTTTAAACTTTTTTTTTCATTTTTTTAAGCAAACTACTTTTGTACGTTTCTTACTTTTAATATCCATCCCTGGACTTTTTATATTCCTCATGTTTGTGATACTGAGAACTGAAGTTCATTTTTTGTGATCTTCATACATTGTAATCTACTTGTGGTAGATATTTAAAAATATTAAACCTTCATTTAAATGTGACATAAAATGCAGCTTTAAACACATAAATATAAAGCAGCTTCCATGAGAAAACTGGTGTAGGCAGGAGTTCCATCTCACAGAATTACTGAGATTTCTCAGTTGTAAGACATGATGTCATCTGCATGCCTCCTGGAATTCTCTAATGGGATTGCCAAAGAACAAATGGAGAAGAAAACTTTACTTCTTTGCATTTTTCTACCTTTAAATAGCAAAGTACCACTACCACAACTACCCCTTGCCCCCTCCCCCATCTTTTTTCTTAAAATTCTCTGGCATTTCAGGGCTCAATATGTTTCCTGATTTCTGGAGAACTGGGCAAGGCCTGAAATTCACCCCTCCCCCACCTCTGCTGGGCGGCCCAGGACCCGTTCTGGGAGAGAGCCCCTCATACTGCCTGGGCTCTCAGCCAAGCGGCCTTGGATGGATGAAGTCAGTGAGTGTGGGGGAGAGGGTGAGCTCACTCAGGGCCCCCAGAGGAAGCTCTCCAGCCTCTGCCCTCCCCCTGACACACAGGGCGGGAGCCCGGGCTATTCGTGGCAGCTGTGGCTGCAGCTGTGCTGCTGTACCCTCCCAGAATGTGTGACAGGCCCAAATGTTCCTGGGAGATATCCCATGCGGGGCTTAGAGTCGCTAATTTGGTTCTGTGTTTTGCCTCAAACTGCACAAAGCTCCCCTAAACAACAATTTCGTATGGTGGGGGAGGGACCAATCCAGAGGCCAAGCTGAGTGTCCCTGAAACCATGGCATCTCCAGGTGGTAAGATAGCAGGAGCAGGAGTTAGGGAGTTACCTGCTTAAAGACTGGAGTCTGAGCAGGCCAGTCTGATACATGCTTCCCGAAGGTCTGTGTTGCACTGTGAACACAGTCTCATGCTGTGCCCTTCATTTCACCCAGAGATATTGACTAAGA