Transcript asmbl_24543

Sequence
Transcript Sequence for observation asmbl_24543 of TGE0004497:
GGTTCAGGATTCGGTGTCGGGATAGGTCCTCCCTCGTGCGGATCGCGAGGCCGGTGGGCTTCTGCTTTCCCTGTCCCCACTGCCCGGCTCGGAGGAGGCACCTCCGCCCCCTTGAGAGAAACGGTCCACTCTGAAGAATCTACACTCGCCGTTATCTGTAGTCATCTCGTAATTGTCGAAGGCCCGCGCGGAAACTTGGCCTGAGCCTACTACGGCTTTGTGACTTGTGTCAGGTTAGCCAGAGGGCTAAATGGAAACAGGAGAAAGTGCTTCTGCGTATCCCTTGAGAATGGTGGTGGGACTGCCAGGAACGGCTTTTCACTTCAGTAGGCGTCTGAAAGGGAAATCGTAGTAACTTAAATAAAGGGGTTCAGGGCTTTGAGAAGTTATGCTTAGAAAGACCCGTGTTTTTTAGCCACAAACACCTAGACGCTAAATAGTAATATCTTCGTAATGGAAATTTCCAGGGATGTGCACAGATAGTCATAGATTTCTGAAGTAGTTAATAAGATGCATTTAAACAAGCTGTCCGTTGAAGGGCTTGTCAATGTTTTTAGCGGTATTCAGATCTCTAGCCAAAACGTTTGACACATGCAGGGAAGGTCCACAGCAGATGCACTAGAAACCAACTTCTTCATTTTTTACCCCACTACTAGGTAAGGGACCTGGAAACCAAGAAGTGACTGCTCATCTAATCCGCTAAAGCTATGTTAGCAGATTGGAGGTAGTAGCATTTTCATTACAGTGACTAAAATTTCAGCACTTTACCCCAATCATGTGGCAGGAGTACTGGCTATTATTGAAACTTGTTCAGTTCCAGCCAAAGTTGGGGGAGGTGATGTACATTTGAGAAGTCATATGTTTGTTTAGAAGTAGGTGTGATAACACTTAAAAATTCTAAGTCAGTTTAGAAGCCTCACACCATTGAAGTTATTACAAGTTTTGGATTTTTGGCATGTCTTTGGGTCTCATGTTGCTTAACTCAATCCCCGCAGGACGTTAAAGCTATCTGGAGCAGTTTTTATCTGGGATTCAAAGTTGTTATTGAAGAAGCATTCTCTTCTAGTTAGAAAATGAATTTGATTCAGAAGCCCCTAAAGACATGGGTACTTAGCAATGAAATAGTAAGTAGGCGTTAATTAACTGCCATTTTTCTCTTACAGCTGTTTGCAGACAAAGTTCCAAAGACAGCAGAAAACTTTCGTGCTCTGAGTACTGGGGAGAAAGGATTTGGTTATAAAGGTTCCTGCTTTCACAGAATTATTCCAGGATTTATGTGCCAGGGTGGTGACTTCACACGCCATAATGGCACAGGTGGCAAGTCCATCTATGGGGAGAAATTTGATGATGAGAATTTCATCCTGAAGCATACAGGTCCTGGCATCTTGTCCATGGCAAATGCTGGACCCAATACAAACGGTTCCCAGTTTTTCATCTGCACTGCCAAGACTGAATGGTTGGATGGCAAGCATGTGGTCTTCGGCAAGGTGAAAGAGGGCATGAATATTGTGGAGGCCATGGAGCGTTTTGGGTCCAGGAATGGCAAGACCAGCAAGAAGATCACCATTGCTGACTGTGGACAACTCTAATAAATTTGACTTGTTTTATCTTAACCACCAGACCATTCCTTCTGTAGCTTGCGAGAGCACCCCTCATCCCGCCTGCTCGGAACACCCTGTTATAATCGGCTCTCGCTGCGGTTCTTTGGGTTCCGGGTTTTCCTTGTACCTCCACGTCTAGCTGGGTTGCAGAGTTAAGTTTATGATTATGAAATAAAAGTTAAACAACAGTTGTCTGTCCTTGTTTGGGTTAGGGTGTTGATGTAGGCTTCATTTTAAGCAGCAGCAGGTTCTAAGCCACGTGCTATGTTTGCTTAATTCCACAGAGTACTGTGTTTTGCTTCCCTGACCCAAGAATTAAATGTCACTGAGTATCTTCAAGGTAATCTGAGTGGAATACCGAAGGTGAAACGGGGACCAGGTTGGGCCAGTGCTCCTTGAAGAAAGTCCCACTTGGCATGTTCAGAGGTATCTATTAAAATTAATGTTATAACAAGTT