Transcript asmbl_24340

Sequence
Transcript Sequence for observation asmbl_24340 of TGE0004477:
GGGAACTACCGCACCCAGATGTGGGATAAGCACAAGGAGGTCTTCCTGCCCTCGACCCCCGGCCTGGGCATGCACGTGGAGGTGAAGGACCCTGAAGGCAAGGTGGTGCTCTCGCGGCAGTATGGCTCCGAGGGGCGCTTCACCTTTACTTCCCACACCCCTGGCGACCATCAGATCTGCCTGCACTCCAACTCTACCAGGATGGCGCTCTTCGCTGGCGGCAGACTGCGTGTGCACCTGGATATCCAGGTCGGGGAGCATGCCAACAACTACCCAGAGATTGCTGCCAAGGACAAGCTGACAGAGCTGCAGCTGCGGGCCCGCCAGCTGCTCGATCAAGTGGAACAGATCCAGAAGGAGCAGGATTACCAGCGGTACCGAGAAGAGCGCTTTCGTCTGACCAGTGAGAGCACCAACCAGAGGGTCCTGTGGTGGTCCATCGCTCAGACCGTCATTCTCATCCTCACTGGCATCTGGCAGATGCGTCACCTCAAGAGCTTCTTTGAGGCCAAGAAGCTGGTGTAGCGTTCTCTCTGTGTGACCTTTCTCTCTCATCTCAATTATTTGGTACTTTCCCCACCCGATACCTTATCCACTTGAGTTGTGAGGGGAAAAAATGGAGAAAGGATTTAAGCCACATTGGTTTCATGGCAGCAAAGCATCCAGATCGGCCACCCATTAACATTGGATACAGGACATTGGTCCAAGCTTTCACAGGTGTCTTGGGGTTTGCGCACAGTCGGAACTGACCCTGGACTAGGCCTTGCTTCTTGCGCCTCCAGTGAGTCCCCTTCATCCCATCACAAAATGAGCAAAGGAAAAATCCTCCCAACTCCTGTAACTTTCTGTCCTCGTCTGCTCACACAGCGGCGACGGAAATGCCCCACCAAGGAGGCCCCACCTCACTGCTCCCGGTTGGTCCTGGGTTCCCTCAGTGGCTTTCTGAATGTAAATAAGGGCCAGAGGCCTTAGAAGATGGAAGTGTTTTTCTATATATTAGAAGTATTTTTTGATAAATTATATATTTTCCTTCCTAGCTGAAGTGTGACTGCCTGTGTGTGACTAACTGAGCCACAGCGCAGCCACCCCACACTCTGTTTGCCCACAGTTCTGGTGACTTCCGCAGCAGCTCAGGATTTCAGCGGGTCGCACAGCCGACGCCCCAGCTGCTCTCAAGGCCTTAGCAGAGGGCTAAGGAGACCCTCTGGGACACCTGTGCCTCCACCGCACGGGGCCTCAGGGTGATGACAGAGCCGGCACTGGCGGGGCGCTCCTCTCTTCCTCGCCCCTTCACCTGTGGTTAAGCCGTGGTAAATGTTTTCTTCAAGGGAACCAGGGTTGGTTCTTTATACAGATTTTTCCAGTGAAATAAAACTTGTTGCAGTAGCTGTGTTTGAGATGAAAATCTGGGGCCAGAGCGGGGCACAGAGGGGAACGGAGGCTGTTGGCCTGGCTTGCTTCAGCAGCTGACCTGGGGAGGCCACAGCGTGTGTGTTCATGGCGCTCGGGCTTGGCTGAGCAAGTCTCTGGGGATGTGGGTGGACAGGTGCTT