Transcript asmbl_24091

Sequence
Transcript Sequence for observation asmbl_24091 of TGE0004449:
CCGGCCGGGGAGGCGGCCTCGGGCACAGTAATGGCAGCGCTGTGAGCAGGGGAACGCGAGTGACAGCCGCCGCCGCCGCCGCCCACCTTCCTCGCCGGGGCCTCGTCCTTCATTCCTTCGGGCTGCCTCCCCTCCCCTTGTCCCCTGCCCCCTGTCCCGCTTCTGCAGAAGATTTCAACACTAAACTTGCACAATGTCTTTGAAACCAAGAGTAGTAGATTTTGATGAAACATGGAACAAACTTTTAACGACAATCAAAGCTGTTGTCATGTTGGAATACGTCGAAAGAGCAACATGGAACGATCGCTTCTCAGATATCTATGCTTTATGTGTGGCCTATCCTGAACCCCTTGGAGAAAGACTTTATACAGAAACTAAAATTTTTTTGGAAAATCACGTACGGCATTTGCACAAGAGAGTTCTGGAATCCGAAGAGCAAGTACTTGTTATGTATCATAGGTATTGGGAGGAATATAGCAAGGGTGCAGACTATATGGACTGCTTGTATAGGTATCTCAACACCCAATTTATTAAAAAGAATAAATTGACAGAAGCTGACCTTCAGTATGGCTATGGTGGTGTAGATATGAATGAACCACTTATGGAAATAGGAGAGCTAGCATTGGATATGTGGAGGAAATTGATGGTTGAACCACTTCAGACCATCCTTATCCGAATGCTGCTCCGAGAAATCAAAAATGATCGTGGTGGAGAAGACCCAAACCAGAAAGTAATCCACGGGGTTATTAACTCCTTTGTTCATGTTGAACAGTATAAGAAAAAATTCCCCTTAAAGTTTTATCAGGAAATCTTTGAGTCTCCCTTTCTGACTGAAACAGGAGAGTATTACAAACAAGAAGCTTCAAATTTATTACAAGAATCAAACTGCTCACAGTATATGGAAAAGGTTCTAGGTAGATTAAAAGATGAAGAAATTCGATGTCGAAAATACTTGCATCCAAGTTCATATACTAAAGTGATTCATGAGTGTCAGCAACGAATGGTAGCAGACCACTTACAGTTCTTACATGCAGAATGTCATAATATCATTCGACAAGAGAAAAAAAATGACATGGCAAATATGTATGTCTTACTCCGTGCTGTGTCCACTGGTTTACCTCATATGATTCAGGAGCTGCAAAACCATATCCATGATGAGGGCCTTAGAGCAACCAGTAATCTTACTCAGGAAAATATGCCAACACTATTTGTGGAGTCAGTTTTGGAAGTACATGGTAAATTTGTTCAACTTATCAACACTGTTTTGAATGGTGATCAGCACTTTATGAGTGCATTGGATAAGGCCCTCACATCAGTTGTAAATTACAGAGAACCCAAGTCTGTTTGCAAAGCTCCTGAATTGCTTGCTAAGTACTGTGACAACTTACTAAAGAAATCAGCGAAGGGGATGACTGAGAATGAAGTGGAAGACAAACTCACCAGCTTCATTACTGTTTTCAAATACATTGATGATAAGGATGTTTTTCAAAAGTTCTACGCAAGAATGCTGGCAAAACGTTTAATTCACGGGTTATCTATGTCTATGGATTCTGAAGAAGCCATGATCAATAAATTAAAGCAAGCCTGTGGTTATGAGTTTACCAGCAAGCTACATCGGATGTATACAGATATGAGTGTCAGTGCTGACCTTAACAATAAGTTCAACAATTTTATCAAAAATCAAGACACTGTTATAGATTTGGGGATTAGTTTTCAAATATATGTTCTACAGGCTGGCGCATGGCCTCTTACTCAGGCTCCTTCATCTACATTTGCAATTCCCCAGGAATTGGAAAAAAGTGTACAGATGTTTGAATTATTTTACAGCCAGCATTTCAGTGGAAGGAAACTTACGTGGTTACATTATCTCTGTACAGGTGAAGTTAAAATGAACTATTTGGGCAAACCATATGTAGCCATGGTTACAACATACCAAATGGCAGTTCTTCTAGCCTTTAACAACAGTGAAACTGTCAGCTATAAAGAGCTTCAAGACAGCACTCAGATGAATGAAAAGGAACTGACAAAAACAATCAAATCATTACTTGATGTGAAAATGATTAACCATGATTCAGAAAAGGAAGATATCGATGCAGAATCTTCATTTTCATTAAATATGAACTTCAGCAGTAAAAGAACAAAATTTAAAATTACTACATCGATGCAGAAAGACACACCACAGGAAATGGAACAGACTAGAAGTGCTGTAGATGAGGACCGGAAAATGTATCTCCAAGCTGCTATAGTTCGTATCATGAAAGCACGAAAAGTACTTCGGCATAATGCTCTTATTCAAGAGGTGATTAGCCAGTCAAGAGCTAGGTTTAATCCTAGTATCAGCATGATTAAGAAGTGTATTGAAGTGCTGATAGACAAACAGTACATTGAACGCAGCCAAGCATCAGCAGATGAATACAGTTACGTAGCGTGATGTCGCTCTCCTCCTGTGTGATGTGAGAAGATCATTGCCATCACCATTTGGCGTGTTCCTGTGGGAAAAAGCAGGCCTGTGCCTCCATAATTTGGTCATTTGGCAGCCCCTGTTTTTCTGCTGTTTACAACATCACCAGTGCCACGTCATGAGCGTCAGAGAAAATGCCTAGAGATATTTCAAGCTCATGTCATTATGACATTTCTTAAAACTTTATTAAAAGAATGAGTGAAGTATTGCTGACATGTGGAAATTTGGTTGGGTACCATGCTTTTTCTCCCCTTCACGTTTGCAGTTGATGTGTTTTTTTTTTAATGTATCTTAAAGGACATAAAATAAAAA