Transcript asmbl_23281

Sequence
Transcript Sequence for observation asmbl_23281 of TGE0004427:
CCCCGCTGCCCCTTGGTCTCAGGAAATTGCACGAACTGTACACCCTGCCTCCTCTCCCGGAGCAGACTTTGGACCTGTCCTCAACGGCCCCGTGCGGATTTCCTGGGCCCATTTGAAATGACGTTCTCGTCTTCCTGATCCCTAGGATCCGTCGACATGAATCCCGTCGTCGTGGTCCACGGCGGCGGAGCCAGCAACATCTCCAAGGACCGCAAAGAGCGGGTGCGCCAGGGCATCATCCGAGCCGCCACCGTGGGTTACAACATCCTCAAGGAGGGAGGGAGCGCAGTTGACGCTGTGGAAGGAGCCGTGACCGTCCTGGAAGATGACCCCGAGTTCAACGCAGGTTGTGGATCTGTCTTGAACGTCAATGGTGAAGTCGAAATGGATGCCAGTATCATGAATGGAAAAGACCTGTCTTCGGGAGCTGTGTCTGCAGTCCGGTGCATCGCAAACCCCATCAAGCTTGCGCGGCTTGTTATGGAAAAGACACCTCATTGCTTCCTGACTGACCAAGGTGCAGCAAAATTTGCTGCAGACATGGGGATTCCAGAAGTTCCCGAGAAGCAACTGATAACAGAGAGAAACATAAAACACCTAGAAAAAGAGAAGAATGAGAAAAGTGCTCAGAAAACAGACCAACAAAAAAACTTGGGAACTGTGGGCGCCGTCGCCTTGGACTCCGAAGGAAACGTGGCTTACGCGACCTCGACGGGGGGCATCGTGAATAAGATGGCCGGCCGAGTCGGGGACACGCCGTGTATAGGATCTGGAGGTTATGCTGACAATGACATTGGAGCCATTTCCACGACGGGGCACGGGGAAAGCATCCTGAAGGTGAATCTGGCCAGACTCACGCTCTTCCACAGAGAACAAGGAAAGACGCTGGAAGAGGCCGCTGACTCGTCGCTGGGTTACATGAAGTCGAAGCTCAAAGGTTTAGGTGGCGTCATCCTGATCAACACAGCAGGAGACTGGGCAGTAAAGTGGACCTCGGCGTCCATGCCCTGGGCCGCCGCCAAGGACGGCAAGCTGCACTCCGGCATTGACCTTGACGAAACCAGTATTGCTGACCTGCCCTAAGCCCCTGGGAGATCGTGTGCTAGGTGCTAGCGTGGAGGACTGTCCCCGTCAAACCACTCACAGCAACCGGCCCAGCTGAGAGCGAGGGACAATCCCAGAGGCGAGCGAGGGACAATCCCAGAGGTGCTCCGCGTGCGAAGCAGGAAAGAAGAGGAAGCTTTGACGACTTCGTCCTTCGCATCCTGCTTTCTTTTCCCAGACTGCTATCAGAATGAAGTTGGATTTTCAGACAGGGGGAGGCCTGGGCTGGGTCAGTAAGGGAAACCAGCCTGGGATCCTTCCTTCCTTCCTTCCTTCCT