Transcript asmbl_13977

Sequence
Transcript Sequence for observation asmbl_13977 of TGE0000235:
CGGGGAGAAGGGAGCTGACGGGCGCCCGGCCGGCTGCGGTCCGTGCGGAGGCTGAGCCGGCCGCGGGCGCGACCGGAGGCAGTTTCCGTTACTATGGCAATGACGGCAGGGACTACAACAACCTTTCCTATGAGCAACCATACCCGGGAAAGAGTGACTGTAGCCAAGCTCACATTGGAGAATTTTTATAGCAACCTAATTTTACAGCATGAAGAGAGAGAAACCAGGCAGAAGAAATTAGAAGTGGCCATGGAAGAAGAAGGATTAGCAGATGAAGAGAAAAAGTTACGTCGATCACAACACGCTCGCAAAGAAACAGAGTTCTTACGGCTCAAAAGGACCAGACTTGGCTTGGATGACTTTGAGTCTCTGAAAGTTATAGGAAGAGGAGCTTTTGGAGAGGTGCGGTTGGTCCAGAAGAAAGATACAGGCCATATCTATGCAATGAAGATATTGAGAAAGTCTGATATGCTTGAAAAAGAGCAGGTGGCCCATATCCGAGCAGAAAGAGATATTTTGGTAGAAGCAGATGGTGCCTGGGTGGTGAAGATGTTTTACAGTTTTCAGGATAAGAGGAATCTTTATCTAATCATGGAATTTCTCCCTGGAGGTGACATGATGACATTGCTAATGAAGAAAGACACCTTGACAGAAGAGGAAACACAGTTCTACATTTCAGAGACTGTTCTGGCAATAGATGCGATCCACCAGTTGGGTTTCATCCATCGGGATATTAAGCCAGACAACCTTTTATTGGATGCCAAGGGTCATGTAAAATTATCTGATTTTGGTTTATGTACGGGATTAAAGAAAGCTCACAGGACTGAATTTTATAGAAATCTCACACACAACCCACCAAGTGACTTCTCATTTCAGAACATGAACTCAAAGAGGAAAGCAGAAACTTGGAAGAAGAACAGGAGACAACTGGCATATTCCACAGTTGGGACACCAGATTACATTGCTCCAGAAGTATTCATGCAGACTGGTTACAACAAATTGTGTGACTGGTGGTCTTTGGGAGTGATTATGTATGAAATGCTAATAGGATATCCACCTTTCTGCTCTGAAACACCTCAAGAAACGTACAGAAAAGTGATGAACTGGAAAGAAACTCTGGTATTTCCTCCAGAGGTACCTATATCTGAGAAAGCCAAGGACTTAATTCTCAGATTTTGTATTGATTCTGAAAACAGAATTGGAAATAGTGGAGTAGAAGAAATAAAAGGTCATCCCTTTTTTGAAGGTGTCGACTGGGAGCACATAAGGGAAAGGCCAGCAGCAATCCCTATAGAAATCAAAAGCATTGATGATACTTCAAATTTTGATGACTTCCCTGAATCTGATATTTTACAACCAGTGCCAAATACCACAGAACCGGACTACAAATCCAAAGACTGGGTTTTTCTCAATTATACCTATAAAAGGTTTGAAGGGTTGACTCAACGTGGCTCTATCCCCACCTACATGAAAGCTGGGAAGTTATGAATGAAGATAACATTCACCCATAACCAAGAGAACTCAGGTAGCTGCATCACCAGGCTTGCTTGGCGTAGATAACAATACACTGAAATACTCCTGAAGATGGTGGTGCTTATTGACTACAAGAGGAAATTCTACAGGATTAGGATTTCTAAGACTACTATAGGAATTGGTTGGCAGTGCCAGCTGGCTCTTTTTTTTAATATTTTATTATTTTTGTTAACTTTATTATATGAAGGTACTGGAATAAAAGGAACAGACATCCCTTTCTAACTGCACTGCCTACATGCGTATTAAGGTCCATTCTGCCTGTGTGTGCTGTGGCTTTGAACTGTAACACCTCTAATCAATTCAGGAGAAACACATATCATTTAAAGCAACATAGGCTAACCTGTAGGTAACACTGCAGTATTGATGTTTTACTGCAAATCTTATGGGTCTAGATAATCAGTAAAAGCCATCTTCCATAGTTGGTGTTAGAACATTGCCCTATTGGTTTGGACATCTGTAGAATATATATGAAGACAATTTCTGTAATGGTTTTAAGAGATTTAAA