Transcript asmbl_22427

Sequence
Transcript Sequence for observation asmbl_22427 of TGE0018348:
GAGCAAGCCAATGACGACCTGGAAAGAGCGAAACGGGCTACGATCATGTCTCTGGAAGATTTTGAGCAGCGTTTGAATCAAGCCATTGAAAGAAACGCCTTCCTGGAGAGCGAACTTGACGAGAAGGAGAATCTCCTAGAGTCTGTCCAGCGGCTGAAGGATGAAGCCAGAGATTTGCGGCAGGAATTGGCTGTGCAGCAGAAGCAGGAGAAACCCAGGACCCCCCTGCCCAACCCGGTGGAAGCCAGCAGGATAGACACTGCTGTGCAGGCCACTGGCTCCGTGCCATCTACCCCTGTGGCCCCCCGGGGACCCAGCTCCAGCTCAGCCACACCGGGGACGTTCAGACGCGGTCTGGAGGACTCCATGGGCGGGACTCCCCTCACACCCGCGGCCCGGATATCAGCGCTCAGCATCGTGGGAGACCTGCTGCGGAAAGTGGGGGCACTGGAGTCCAAACTTGCATCCTGCCGGAACTTCGTGTATGAGCAGTCCCCAAACCGAACAAGCGGCCCGGCCTCAGGACGGGGGAGCAAGAGCAGAGATGGCGGCGACAGACGGCCAGGCAGCACCAGCGCACCTCTGGCTGATAAAGGGTTGGACACCAGTTGCCGCTGGTTGTCCAAATCGACGACCAGGTCGTCCAGCTCCGGCTGAAGCCTGTTCTTGGTCTTTTCCAGTTTGTCATAAGCAGCGGCCTTCTCTTCGTACTGCTGGGTCCGAGATGTGGCCCTCCAGCTCCCGGATCTTCTTCAGGGCGTTGTTCTTCTGAGCGATTTCATCGTCGAGCCTGC