Transcript asmbl_22426

Sequence
Transcript Sequence for observation asmbl_22426 of TGE0018347:
GAGCAAGCCAATGACGACCTGGAAAGAGCGAAACGGGCTACGATCATGTCTCTGGAAGATTTTGAGCAGCGTTTGAATCAAGCCATTGAAAGAAACGCCTTCCTGGAGAGCGAACTTGACGAGAAGGAGAATCTCCTAGAGTCTGTCCAGCGGCTGAAGGATGAAGCCAGAGATTTGCGGCAGGAATTGGCTGTGCAGCAGAAGCAGGAGAAACCCAGGACCCCCCTGCCCAACCCGGTGGAAGCCAGCAGGATAGACACTGCTGTGCAGGCCACTGGCTCCGTGCCATCTACCCCTGTGGCCCCCCGGGGACCCAGCTCCAGCTCAGCCACACCGGGGACGTTCAGACGCGGTCTGGAGGACTCCATGGGCGGGACTCCCCTCACACCCGCGGCCCGGATATCAGCGCTCAGCATCGTGGGAGACCTGCTGCGGAAAGTGGGGGCACTGGAGTCCAAACTTGCATCCTGCCGGAACTTCGTGTATGAGCAGTCCCCAAACCGAACAAGCGGCCCGGCCTCAGGACGGGGGAGCAAGAGCAGAGATGGCGGCGACAGACGGCCAGGCAGCACCAGCGCACCTCTGGCTGATAAAGGGTCGGGAAAACGCCTGGAATTTGGGAAGCCGCCTTCCAATCTGTCCTCGCCATCGCTGCCGTCAGCCCAGGGTGTAGTCAAGATGTTGCTTTAGAAAATCCACAGAAGCGAAGCTGCCGATGTCTGTGCGGGAGTTGTCACCTGTTCCCCTCTTTACACTAGGTTTTTATTTTTCTTTCTTTTTTTTTAAGTTAGTCTGAGAAATACGAGTGAACAGTCATACTAGCCATTGACTGAGGCTGATGCCTGTGGTCCCCGTGAACTGTTGTCTCGTGAACCCCAGCCTCCTTGTCAGTGTGTTGCAAACGGACCCCCCTGGAAGAGGGTGCTCAGGTGTGCTGCTGAGGCGACCCTGTCATTTCGAGCTGACCCGGGTCCTGCTTGGTCTCGAGAGGTGGTTTGAATGTCCACAGACGCCTCACGAATGGGATGTGAGCCACGTCGAGCCCACCCCGGCCCCACTTGGCACAGGATGGCACAGCAGGGTCAGCACGCTGAGAGCATGTCTAGGGGCGAAGGGTGGCCTGGGCACAAGCCTGTTTTTAAAACTGTGGTGTAGTGTACCTCCCACGCTTTTTATTCTGCCTCTCACGGAGGCTTTTAGAGGTGTGCTCAAGTTTTAGAGTAAATTTTGTGTGGACCAGGTCAGTGGAAAATCTGTGTCTTCTTTAGATCTGTCCCAACCGTTAATTGTCCTCGGTCCCCACCCCTCGCGTGGTGGGGGGGAGGACCTCCGCTTCAAGACCCTGAGGGTCACTGGGATGGAGTGGCCTCTTAATATGCAGCTTTTAAGAATAGGACTTTATTCAAGGCCATAATGACATAATCAGGGTGACCTTCAAATAAGATGACACCATCGCACACCAGGATTGTTGTCGGGAGCGTCCTTGTCAAAGGAGCAGCAAACACGAGATTTCCCACGCGGACGGGGTCTGTACTTAACCTCTGCTTGTGCGAGCTGCTGTCTCACGCTTTCGGTCACGTGTGAAAAGAACACAAAGTCAGGAGCATGTGTGTGCAGCTTAACGACCTTCCTTTTGTTACGAAGTTCTTTTTTCCAAAAGAACACCAAAATAGCCTTGATTTGAAAATAGACTCTTTCAAGTGTTACTAAAATTCAACAGAATCAAACCTCAGTGCTCAGTTCGTTACCCTACCAACATTCTAACCCAGGTCGACGAAAGATGTACCTTTACTTTTTT