Transcript asmbl_22059

Sequence
Transcript Sequence for observation asmbl_22059 of TGE0004288:
CGCACCGCGAATCACTTGTCAGCGCTCGTCTGAGGCGGAGGCAGCGCCGCGCCGGACCCGAGTTTCTTTCACTTTCTGGGATTGAATTTTGAGCCATCAAAACCATGAGCAACTACAGCGTGTCCTTGGTTGGTCCTGCTCCTTGGGGTTTCCGGCTGCAAGGTGGCAAAGATTTCAACATGCCTCTGACAATTTCTAGTTTAAAAGATGGCGGCAAAGCCTCCCAGGCGAATGTGAGAATAGGTGATGTGGTTCTCAGCATCGATGGAATAAGCGCCCATGGAATGACTCATCTTGAAGCCCAGAACAAGATTAAGGGTTGTACAGGCTCTTTGAATATGACTCTGCAAAGAGCATCTGCTACACCCAGGCCCGAGCCGGTTCCTGTTCAAAAGGGAGAACCTAAAGAAGTAGTTAAACCTGTACCCATTTCATCTCCTGCTGTGTCCAAAGTCACTTCCACAACCAACATGGCCTACAATAAGACACCACGGCCCTTTGGTTCTATGTCTTCACCAAAAGTCACATCCATCCCATCACCATCGTCCGCCTTCACCCCGGCCCACGCGACCACTTCATCACATGCTTCCCCTCCCGTGGCTGCTGTCACTCCTCCCCCATTCGCTGCATCTGGACTGCATGCTAATGCCAATCTTAGTGCTGACCAGCATTCACCTGCACTGAGCGCTGGTAAACCTGCAGTTAATGTCCCACGGCAGCCCACAGTCACCAGCGTGTGTTCCGAGACTGCTCAGGAGCTAGCAGAGGGACAGAGAAGAGGATCCCAGGGTGACAGTAAACAGCAAAATGGCCCACCGAGAAAACACATTGTGGACCGTAACACGGAGTTTTATCACATACCCACCCACAGCGATGCCAGCAAGAAGAGACTGATTGAGGATACAGAAGACTGGCGTCCGAGGACGGGCACAACGCAGTCTCGCTCTTTTCGAATCCTGGCCCAGATCACTGGGACTGAACATCTGAAAGAATCTGAAACTGATAATACAAAGAAGGCAAACAACACCCAGGAGCCTTCTCAGCATTTGGCTCCATCAGTAGCTTCAGCACGGAGCATGCCTGAGAGGCCAGGAAGCCCAGCCTCTGCCAGACCAGGGGTGGCTGGTCTCACAACTGCTGCTGCCTTCAAGCCTCTAGGATCCACCAGCACCATCAAGTCACCAAGCTGGCAACGGCCAAACCAAGCAGCACCTTACACTGGAAGAATCTCAAATAGTGCAGCTTCCTCAGGAGCAGTGGGACCAGCCGCCTCCTCTGTGGGGCAGCCCCAGCCAAGTGACCAGGACACTTTAGTGCAACGAGCTGAGCACATTCCAGCAGGAAAACGAACTCCAATGTGTGCCCACTGTAACCAGGTCATCAGGGGACCATTTCTAGTGGCACTGGGGAAATCTTGGCACCCAGAAGAATTCAACTGTGCTCACTGCAAAAATACAATGGCCTACATTGGATTTGTGGAGGAAAAGGGGGCCCTGTATTGTGAGCTCTGCTATGAGAAATTCTTTGCTCCTGAATGCGGTCGATGCCAAAGGAAGATCCTTGGAGAAGTCATCAATGCTTTGAAACAAACTTGGCATGTTTCCTGTTTTGTGTGTGTGGCCTGTGGAAAACCCATTCGTAATAATGTTTTTCACTTGGAGGATGGTGAACCCTATTGTGAGACGGATTATTATGCCCTCTTTGGTACTATATGCCGTGGATGTGAATTTCCCATAGAAGCTGGCGACATGTTTCTGGAGGCTCTGGGCTATACCTGGCATGACACTTGCTTCGTATGCTCAGTATGTTGTGAAAGTTTGGAAGGTCAGACCTTTTTCTCCAAGAAGGACAAGCCTCTTTGCAAGAAACATGCTCATGCTGTGAATTTTTGAAAGTCAACAGTTCAAGAGAAGAGAAGAAATTTGAAAAGAAAGAGGAGAATTAAAATTACCAATTAATTTTTAGATTTAATATTTATATGGAGTTTGAAAAATAATAGTGGCCCTGAAGGGATAAATTCCAGCTTTAAAAACCGAGTCTTTGAAGAAATATTTGGCTACATAACGTAAAGAGACAGTTTGGCATTTATTATTACTTTTTTCCCTGTATTTTCTGCCCATAAAATAACTTTCATAAAAATCAATTTCCTGGTTGACTATTAAATTCATCTTAGAATAAATTAGTAAAGAATTAAATTTTAGAAAATCTCAAACCTCTATGCTGAAATAATTATGGTTTCTTTCCTTGTTATGAGTAAATCTGTAAAAGGCAATGAAAGTGCCTTATACTTTTATCATTAAATGAAACATTGTATTTTTTTTAAGAATAATGTTTATCTTTAAAACAGTAAATAGGAGTTTAAACAGAGCATTTTATCAGTAGGTGTCAATTTTTACAAACTGTGTACATTTTTTTTGTCTTACAATCGATCATTCCAGTAGGAAAGATCAATGAGATTTTTCATCAAAATGCATCATGCCAATAAGAGATGCTATATTTTTCTTCATCCCTTTCAAAAGCTACCTACCATATGGCTTATAAATCTCAAATTTTTGCCTTTTATTAAAATATGGCCATTCCTATTCATTGTGTGTGTTTTATCGCCTATATTAGTCAAACTCTTTTTACCCCCGCTCCTTCATGCTGAGGTAAAGAGCTAATTGGATAACTTTGGACTGTAACAGTTTTCTCTCTATATAAAGAGAATAAGTAGGAAAGAATGTGGTTGTATCCAAAATATTCTCCTCCCCAATTCAGATCATGAATCGGTTTCAGAGTTGTACTACTGACAAGTGAAGGTTTGAGAACTCTCTTTGCAGAGTATTTTTTTCTTTAATTCTACATTAGAAAAATAAAAGATTGGCTTGGGGATGTGATAAAATCTTGATTGTTTTTTTCTTTTGATCATTCTCTTTCAGTAATAAATGAACCACTTCTAAAGGTGATCATGAAGTTTGGAAACTTTTATTCACAGAGGTTTGGTAGTATAGGAGGGCATATGATTAATTACTCAGACTAGCCCATTATTTGTTTTCTTCATTTGGGGAAAATTATGTGGATACCACATGAAGACAGAGAAACAATTGTGGTAAAATTGTAGATCCTATTGATATTTGCCCAGTGAGAAAAGCAATTATGGCATTTGATAGTTTTTCTCTTTGTTTTCAGATATGATGAAAGCCCATGATCCCACTAAGTTATAATTTAAATTCATTTGGAGCAAGATGCTTTTAAAGTTGAGGCTGAACCCGAAGTCTTTCCTGCCCCATCATCACTCACTAATTACTTCACTTCCATTGTGTACATGTTTGTTATAGAGGGAGGTTTTAAGCTACAATATTTGTTTAACCTCCCTAAGAACTTTTCAAGGCATCTGTCCTGAAAGTTGTTAATATATGGTCTAGCAGATTTAAATTATATACAGATAATAATTAACTGGGGATAAAAGAATGAGAAGGATGACACAAAGTGGCAAACTGAATACTTCACTTATAGTAACCCCAAACCACCTCCTCACCTTGCATCTTGCAGGGAGGCAGGAAGTTTTTTTGTTTTTTTTGTTTTTTAAGTGCTGTAACTGAATCATGCATTATTTTTCATTGCTGCTGAAACTACCTATAGAAGACATGCTGGCTAATGTGCCTTGTCACATATCTTGATGTCAGCCTTTTGCTTCACACAGCATAAAATAAGTTGGTGGTTTTGTTTTGATGTGGTAGAAGTTTTTTTTGTTATTTAGTTTTGCATTTATGGATTTTATATACAAAAATTGTATTTGGTAAGTCAGTGGTAGTTCCTTCAAAGAATTTTATTTGACCTGGGTTTCTTATAAAGTTATATTAACAATATCATTTTTATAGACTTTTCTTTCTACATATTATTCATGGAGCATAATGTTGCATTTCTCTAAATTTTATCTCGAAAAAGG