Transcript asmbl_21382

Sequence
Transcript Sequence for observation asmbl_21382 of TGE0004263:
AACCTACAGGACAATGCATACCACCGACTGCCGACTGTAAACATAGGGGATGTGTGTTCACTTAGCACGGACTTCTGGGAGGGGCTAAGGAAGGGCGGTCTGGAGTTTTATTGAATAGAGCAGTGTGTATGAGGCTGCCTGCCTGCCTGCCCTCTTGCTGTGCTCCTGCTTAAAGAAATCAGTCCTTCCTGTCCGACTTAGTCCTAGGAAGAAGTTTCAGCCTACGAGATATCATTAAAACATTCCAAGATCATCCAGTCGAATTCTACAGGGATTGGCGATCAACCGGAACACTCTGACGTGGATATCTGATTGCTTACCTGTCCAGACATCATCTGGTCTCCTTAAACCTGAAACCACACCATGGATGACTTTGAACGTCGCAGAGAACTTAGGAGGCAAAAACGGGAAGAGATGCGCCTGGAAGCAGAAAGAATCGCCTACCAGAGAAACGACGACGATGAGGAAGAGGCCGCCCGGGAACGGCGCCGCCGAGCCCGACAGGAAAGGCTGCGGCAGAAGCAAGAGGAAGAATCTTTTGGGCAGGTGACTGACCAGGTGGAGGTTAACGCCCAGAACAGTGTGCCTGACGAGGTCAAGACAACCACGGCGAACACTCAGGTGGAGGGCGACGACGAGGCCGCGTTCCTGGAGCGCCTGGCTCGGCGGGAGGAGAGACGCCAAAAACGCCTCCAAGAAGCTCTGGAGCGGCAGAAGGAGTTCGACCCCACAATAACGGATGCAAGTTTGTCGCTACCAAGCAGAAGAACGCAAAACGACACAGAAGAAAACGAACATGCAGAGAAGGAAGAAATCAGTGAAAGTCGCCAAGAAAGATACGAGATAGAGGAAACAGAAATAGTCACGAAGTCCTACCAGAAGAACGACTGGAGGGTTGCTGAAGAGAACAAGAAAGACGAAAAAGAAAAGGAGGGAGAGGAAGAAGAGAAGCCAAAGCCAGGGAGCATCAAGGAAAATCAGATCAAAGATGAGAAGATGAAAAAGGACAAAGAGCCCAGGGAAGATGTTAAGAGCTTCTTGGATGGAAAGAAGGGATTCACAGAAGTCAAGTCGCAGAATGGAGAATTCGTGACCCACAAACTTAAACACACTGAGAATACTTTCAGCCGTCCCGGAGGGAGGGCTGGCGAGGCCAAGGAGGCGGAGGGCGCGTCCCAAGTGGAAGCGGGCAAGCGCCTGGAGGAGCTGAGGCGCCGCCGTGGGGAAACCGAGAGCGAAGAGTTCGAGAAGCTCAAACAGAAGCAGCAGGAGGCAGCCCTGGAGCTCGAGGAGCTGAAGAAAAAGCGGGAGGAGCGAAGGAAGGTTCTGGAGGAGGAGGAGCAGAGGAGGAAGCAGGAGGAAGCCGATCGAAAAGTCAGAGAGGAGGAAGAGAAGAGGAGGCTAAAGGAAGAGATTGAAAGGCGAAGGGCAGAAGCTGCTGAGAAACGCCAGAAGATGCCAGAGGATGGGTTAGCAGATGACAAGAAGCCATTCAAATGTTTCACTCCTAAAGGTTCATCTCTCAAGATAGAAGAGCGAGCAGAATTTTTGAACAAGTCTGTGCAGAAAAGTGGTGTCAAATCAACTCATCAGGCAGCAGTTGTCTCCAAGATTGACAGCAGACTGGAGCAATACACCAGCGCCATCGAGGGAACGAAAACCGCAAAACCTACAAAGCCAGCAGCCTCGGATCTTCCGGTTCCTGCCGAAGGTGTTCGCAACATGAAGAGCATGTGGGAGAAAGGGAATGTGTTCTCATCCCCCGCTGCGTCGGGCACGCCAAACAAGGAAACTGCTGGCTTGAAGGTGGGGGTTTCCAGCCGCATCAATGAATGGCTAACCAAAACCCCAGATGGAAACAAGTCACCTGCTCCCAAACCTTCAGATTTGAGGCCAGGAGACGTATCTGGCAAGCGGAACCTCTGGGAAAAGCAATCTGTGGATAAGGTCACATCCCCCACTAAGGTCTGAGACAGTTGAAGAAAGAACCCCAGAGTAGCCACTCAAGATGCTGGACCAGCTCAGCTGAAGAGGGTTAATGTGCTCTGTTTTATATTTATGTTGATTTACTAAATTGGGTTCATTTCCTTTTGTTTTATTTTCCATTATCCCGGTAAACCTATGTATATTATCACCATATTTAATAATCACAGTCTAGAGATGTTCATGGTAAAAGTACTGCCTTTGCACAGGAGCCTGTTTCTAACGAAACCCATGCTGTGAAATAGAGACTTTTCTACTGATCATCAGAACTGTGTGTGAACAGTGATACCAACCACATTGGAAGTCAAACAAAAGGAGATTCAAGTTGAAAATTGCCTGAGGAATGTGTGCAGTATCCAGAAAAATGAACCGTAGTGGGTTTTGGGTTTTTTTTTTAATTTTAAATACAAAAGTCATGTTGTTTCTGCACTTTAAAGCATGGAAGAAATTATCTTAGTAGGCAATTGTAACACTTTCTGAAACTAATTCATTTCAGATTTGAGATACTATAATGATGATTGTCTTTTTAAAAAAAATGTATTGTTAAGGTATTACTTTTTTCATGCTGATGAATATCTAAATCGGATAAGGATTTTAGCTGACAGGGGTACTGATTTATTTAGGTTGGTTGCTTTGTGGATTTCTTTGGTAGTGATAGTGAACCACATTTTAGATGACCTGATCATATATGTATGTGCATACACATATACAAACACACTAATGGTAGAAAGCTTTTTCATGTGCTAGACTATTGTATTTAGCAGTATGTCCTTGTAACTAGACAATATCACAGCTTTTTAAAAATTACAAATCACAATATTCTATTAATATTTCATATTTGCCAATGGAGACATGGCAGAATAGGTATCGATATGTTTTCGATGCCCGATAGATGACCTATAAGGAAAAAGAGAGATTAGAAATATCAAAATGTCAGTTTATAGAATCAACATTTTCTATGAAACATAATATTTAGCTTATAATTAAAGGCAATCTTGAAGGCCAATGTGAATTTTACTAAATCTACCATCTGGATCAAACTCAAAGCTTGCCCAAAACTTTATTCTGTTAATAAGCGAGTTCACAATAGGTTGGCCTAAATGATACCTGAGGTCTCTTCCTTTTTTCAAATTTAAAGACAAGAATTTTAGTGACAAGATTGTGCAGACTGAAATTCCATGGACAGGTATACAAAGACCAACTTTGGCTAATGTCTAGAAGCAGGGAAGAAAAGTAAGCAAAACCCACTGTTTAGAAGTCATGACAATACTTCCATCTTTAATATACTGAACCAATTTTTAAATTAAACTTTTCTACTTATATTATTAGTCATTGGTACTTATCATAAGTTGATAATGTGTCGAACTTTGAAGAAGTATATATAACTTTTATTAGTTTTATCTTTTTCCCCAAGAGTCTTCACCAACTCATCATTTTTACACAATCCAGATATCAGATCTTATTTTAGCTTATACGTGTCCATCTGTTCTTCCCAATAGATGATAAGAGTACTCCAGTGTCTTGGAAATATGTTCTAGCATAGAGATATATAGGGTAGTTCTATAAACTTATACCTCATTTGACTTAACCAAAATGGTCCTAGTCTCAATTCCTACCACAATGAGGGAACCTCCCAAATGACTCTTTTCTAGCTCTTTTTTGGAAGAGCTAGCCAGGGCAGTGCTGGCATGAAGAGTGACCACTGCCTGACAAAGTCTATCTTCCTCAAAAATTAGTAAAGAGTAATTGAATTCTCTAGCTTTTAGCGCACCTGGGACAAAGCAAGGAAAGCCGCCTAGACTGCACAAATCATCTGCCCAAGACAGAGTAGATATGAGTCTGTGATAAGATGAACTATAATCCACAAGTAGTGCCTGATTTAGCATTGACTCCCATCATTGGGATGAAACAGATCAAAGTTTGAATTAAGGCCCATGGCGATGTAACATTGCTTTGTTGTACTTTTGAACAAGAGCTTCGCCTGATCACTATTATATATGTTTTTCTAGAAAATCTAAAGTTGAGAAGAGAATATGTCGATCCTGACTTTTATTCCAATATTTGGATGGAATAAATTTTAGGGTAGAATTTTGTTTAGTTTGGATTTAATCTTTTGAAAAACAAATTCTTTGTTTACCTGTTTGATTACAACGCTCTTTGTTATCTTTAAGAGGTAAAGCTGCAAAGTGACTAGCATGTTCTGTGAATCTGCCATTCCTAAAAATTTTATAAACACTTGATATTTGTCACTGATAATTGATCGCTGCAATAAATATGTATTGTGAAAAAGCATCCACAATAAATGGAATTCCTCCAAA