Transcript asmbl_21379

Sequence
Transcript Sequence for observation asmbl_21379 of TGE0008578:
GGGAATAATCCCGGCGAAAATCGACATATGTGAGCTAGAGCAGATTTTCGAATCGTTGTACGCCTGGGTCGGTCGAGCGTGCAGTTCGGAGGGGATAGCGTGGTACCTTTCTGTTCAGGTGTCGCCCCGGGCAGCCTCACCCTTTTCTGGGGTTTCCGTGCGGCACAGGGCTCCGTTGGTGCGCATCCAAGATGGCGACGCTGTTGGCGGTAAATTCGGCTGCTAGTCTATGGGGTCCTTACAAAGACATTTGGCAAATGGTGGGAAATGCTCTCTGGAGAAGACAACCCGAAGCTGTCCACCTGCTCGACATGATTCTGAAGAAACATAAGCCAGACTTCATCTCACTGTTCAAAAATCCACCAAAAAATGTTCAACAGCATGAGAAGGTTCAGAAGGCTAGTACAGAGGGAGTCGCCATCCAGGGTCAGCAAGGGACCCGACTGCTTCCGGAACAGCTCATTAAAGAGGCCTTTATCCTCAGCGATCTTTTCGATATTGGAGAACTGGCTGCTGTGGAGCTTCTCCTTGCTGGAGAGCACCAACAGCCACATTTTCCTGGCCTCACCAGAGGATTAGTAGCTGTCCTCTTATATTGGGATGGAAAGCGATGCATTGCAAATTCCCTGAAAGCCTTAATACAGTCTAGACGAGGAAAGACATGGACCCTCGAACTCAGTCCAGAGCTGGTTTCCATGACAACACGCTTTACAGATGAGCTGATGCAGCAAGGGTTGACTTATAAAATCCTTACTCTGGTGTCACAGATTGATGTGAACAATGAGTTTGAGAAACTACAGCGTGAGAGAGGTTTGGGCAGCGAAAAACATCGCAAAGAGGTTTCCGATCTCATCAAGGAGTGCAGGCAGTCTCTGGCAGAAAGCCTTTTTGCCTGGGCTTGCCAGTCACCATTAGGCAAAGATGACACTCTACTCCTTATTGGACATTGGAAAGAGTTTTTTTAAGAGTGACAGTTGAGGCTAATGGCTCATTGGATACAGTGAATCTGGCTCTTCTTATGGCACTTCTGTACTGTTTTGACATCAGTTTTCTAGAACAGAGCACAGAGGAACGTGATGACATGATTCATCAACTTCCACTATTGACAGAGAGACAGTATATTGCAACAGTTCACTCTCGCCTTCAAGACTCACAGCCTTGGAAACTGCCTGGACTGCAAGCCACTGTTAGACTTGCCTGGGCACTGGCACTGAGGGGAATATCTCAGCTACCTGATGTGACAGCTCTGGCTGAATTCACAGAAGCAGATGAAGCAATGGCAGAGCTCGCAATTGCTGACAATGTTTTCCTGTTCCTCACTGAATCCGTAGTAGTGTCAGAAAACTTCTATCAGGACGAATTTTATATTCGTAGAATCCATAATCTCATCACGGATTTCCTTGCACTTATGCCAATGAAGGTGAAGCAGTTGAGGAATCGGGCAGATGAAGATGCTCGAATGATTCACATGAGTATGCAGATGGGTAATGAACCCCCCATTTCACTTAGAAGGGATCTGGAACACTTAATGCTATTGATTGGTGAGCTATATAAAAAGAACCCTTTTAATTTAGAGCTTGCTCTGGAATATTGGTGTCCCTCAGAGCCTCTTCAGACGACCACTCTACTGGGTTCTTACCTTGGGGTGGCTCACCAGCGACCCCCTCAGCGCCAGGTTGTCTTGTCAAAGTTTGTTAGGCAAATGGGTGACCTGTTGCCTCCAACTATTTATATTCCTTATCTGAAAATGCTCCAGGGGTTGGCCAGCGGGCCCCAGTGTGCCCACTACTGTTTTAGCCTGCTCAAAGTCAACGGTGGCGGTCATGTTGAAAATATTCAGGGAGCAGGGGGCAGTCCTGTTTCCTGGGAACATTTCTTTCACTCCTTAATGCTTTACCATGAACACCTCCGGAAGGATCTTCCGAGTGCAGACAGTGTCCAGTACCGTCACCTTCCTTCGCGTGGCATCACCCAGAAGGAGCAGGATGGACTGATCGCTTTTTTACAGCTCACATCTACCATCATTACGTGGAGTGAAAATGCTCGTCTGGCACTCTGTGAACATCCTCAGTGGACCCCGGTTGTGGTGATTCTGGGACTCCTGCAGTGCAGTATCCCCCCTGTTCTAAAGGCCGAGCTGCTGAAGACACTGGCAGCTTTTGGAAAATCTCCTGAAATTGCTGCTTCCCTCTGGCAGTCATTGGAATACACCCAGATACTGCAGACTGTAAGGGTTCCAAGCCAGAGGCAAGCTATTGGTATTGAGGTCGAACTAAATGAAATAGAATCCCGGTGTGAAGAATACCCGTTGACTCGGGCCTTTTGCCAACTTATTAGTACCCTGGTGGAGAGCTCGTTTCCTTCTAATTTGGGTGCTGGACTGCGGCCCCCTGGCTTTGACCCTTATTTGCAGTTCCTCAGAGATTCTGTGTTTCTCCGATTCCGCACAAGAGCTTACCGGAGAGCAGCTGAAAAGTGGGAAGTTGCTGAAGTTGTTTTGGAAGTGTTTTATAAATTGCTTAGAGATTATGAGCCCCAACTTGAAGATTTTGTAGACCAGTTTGTGGAACTACAAGGAGAAGAAATCATAGCCTATAAGCCACCAGGATTTAGTCTGATGTATCATCTTCTGAATGAGTCACCAATGTTGGAGCTTGCTCTTAGCTTACTGGAAGAAGGCGTTAAGCAGCTGGATACTTATGCCCCTTTCCCTGGGAAGAAGCATTTGGAGAAAGCGGTACAGCACTGCCTTGCCCTTCTCAATCTTACTCTGCAAAAGGAAAACCTCTTTATGGATCTTCTAAGAGAGAGTCAACTGGCTCTGATAGTCTCTCCTTTAGAACAGCTTCTGCAGGGCATCAATCCCAGAACTAAGAAGGCTGATAATGTGGTGAATATTGCCAGATACCTGTATCATGGCAATACTAATCCAGAATTGGCTTTCGAAAGTGCCAAGATCCTCTGCTGTATCTCTTGCAACACCAATATTCAGATAAAATTGGTTGGAGATTTCACACATGACCAGAGTGTAAGTCAGAAGCTGATGGCTGGATTCGTGGAGTGTTTGGATAGTGAAGATACAGAAGAATTTGTACGTTTAGAAGAGGGATCAGAACTTGAAAAGAAATTAGCTGGCATCCGTCATGAAACAAGAATCCACATCTTGAATCTTCTCATCACCTCTTTGGAACGCAATCCACCCAGTCTTGCTCTCTACCTGTTAGGCTTTGAATTAAAGAAACCTGTCAGTACCACAAACCTACAAGATCCAGGAGTGTTAGGCTGCCCTCGAACGTGCCTTCACGCCATCTTAAACATCTTGGAGAAAGGAACGGAAGGGAGGACAGGCCCGGTGGCAGTGAGAGAATCGCCTCAACTCGCTGAGCTGTGTTACCAGGTGATATATCAGTTATGTGCATGCTCCGATACATCTGGCCCTACTATGAGGTACTTGAGAACCAGCCAGGATTTCTTATTTTCTCAATTGCAACATTTACCTTTTTCTAATAAAGAATATGAAATATCTATGTTGAACCAAATGTCATGGCTGATGAAGACTGCTTCGATAGAACTAAGGGTAACCTCTCTGAATCGTCAGCGGTCACATACCCAGCGGCTCCTGCACCTCTTGTTGGATGACATGCCAGTGAAACCATACTCAGGTGAACATGTGAATTGTTGGCATTTGTTTTATTGTGCTGCTGACGGATCTGGGTGAATTCAAGCACGAAGCTGAATCTTGTGCTTAGTATGTGATTGCAGGCCAAAGAAGTTCCTTCTACCTTTAGAATTTTTTT