Transcript asmbl_21376

Sequence
Transcript Sequence for observation asmbl_21376 of TGE0018316:
AGGACCTCATTCAGGCAGAGGACCGACAACTGATTATTCGTGATATTTTACAAGATGTGCATGATAAGATCCTGGATGATGAAGCAGCACACGAGTTAATGCCGGTGGTAGCAGGTGCTGTGTTCACCCTGACTGCTCACTTGAGCCAGGCCGTTCGCACAGAACAGAAGCATCCATTAGCCTTGAGGCCTGGAGAGGCCCATTACGCTTTTACGCTCGATGGTTGTTTCACCTCACCTCCTCCAGCAGAGAACCCAGTGGTGGGTTTTGCTTCTATTGGAGATTCTTCACTTCACATCATATTGAAGAAACTGTTAGACTTCATTTTGAAGACAGGTGGCGGATTCCAGCGAGTGAGGACACACCTGTATGGCTCTCTGCTTTATTATTTACAGATCGCCCAGAGACCAGATGAACCGGACACCTTAGAAGCAGCCAAGAAAACCATGTGGGAAAGATTGACAGCTCCTGAAGACGTGTTTAGTAAATTGCAGCGAGAAAACGTAGCCATCATCGAGAGCTATGGTGCCGCCCTCATGGAGGTGGTTTGTCGGGACGCTTGTGACGGCCATGAGATCGGAAGGATGCTGGCGCTGGCTCTGCTTGATCGGATCGTCTCTGTAGACAGGCAGCAGCAGTGGCTTCTGTACCTCTCCAACAGTGGCTATTTGAAGGTGCTTGTGGACAGCTTGGTAGAAGATGACCTTACGTTGCAGAGCTTACTCACCCCACAACCTCCGCTTTTAAAAGCCCTTTATACCTATGAATCCAAAATGGCATTTCTCACGAGAGTAGCTAAGATACAGCAGGGTGCCTTAGAGCTGCTGAGATCTGGGGTGATCGTGAGACTGGCACAATGCCAAGTCTATGACATGCGCCCAGAAGTGGACCCGCAGGGCGTGTTTGGCATGAGAGACCCCCCAGTGTTCATCCCTACTCCGGTGGACCGGTACCGCCAGATTCTCCTTCCGGCTCTCCGCTTGTGCCAGGTCATCCTCACGTCTAGTATGGCCCAACACTTGCAGGCAGCAGGGCAGGTGTTGCAGTTTCTCATTTCGCATTCTGATACCATACAAGCAATCCTGCGCTGCCAGGATGTTAGTGCTGGGTCTTTGCTGGAGTTGGCTCTGCTCACAGGAATTATAAGTAAAGCAGCACTTCCTGGTATATTAAGTGAACTTGATGTGGATGTAAATGAAGGATCTCTAATGGAGCTACAGGGACATATTGGAAGGTTCCAGCGCCAGTGCTTAGGACTACTAAGTCGCTTTGGTGGCTCGGACAGACTCCGTCAGTTTAAATTTCAAGATGATAATGTGGAAGGAGATAGAGTGAGCAAGAAAGACGAGATTGAACTGGCTATGCAACAGATTTGTGCCAATGTCATGGAATATTGCCAGTCGCTCATGTTACAGAGTTCCCCTACCTTTCTGCATGCCGTGTGTCTCTTCACCCCAAGCCTGTCAGAAACCGTTAACAGAGATGGGCCCCGGCAAGATACCCAAGCTCCAGTAGTTCCGTATTGGCGCCTGCCTGGTTTGGGCATTATTGTCTACCTGCTGAAACAGAGCGCTAGTGATTTCTTCAGCTATTATGACAGTCACCGACGGAGTGTCAACAAGCTACAGAATGTAGAGCAGCTTCCACCAGATGAGATAAAAGAGTTATGTCAGTCTGTGATGCCTGCTGGTGTTGATAAAATCTCCACCACCCAGAAATATGTTCTAGCAAGACGGCGTTTGGTGAAGCTGATCAACAATCGAGCCAAACTGCTTTCCCTTTGTTCTTTCATCATAGAGACCTGCCTCTTTATCCTCTGGCGCCATCTGGAGTACTACCTGTTACATTGCACGCCCACAGATTCGCAAGATTCCTTGTTCGCCTCCAGGACCTTGTTTAAAAGCAGAAGGCTACAAGATTCCTTAGCTTCAGAAGCCAATCTAGATTTTAGAAGTGGACTGACTATAGTGAGCCAACATGACATAGACCAGCTCCAGGCCGACGCTATCAACGCCTTCGGAGAATCACTGCAAAAGAAACTTCTGGACATTGAAGGATTATATTCAAAAGTTCGATCTCGCTATAGTTTCATACAAGCTCTTGTCAGACGTATCCGAGGCTTACTGAGGATATCACGGAACTGAGCTCTTCTAGGGAAGAGATGAATTGGAAAACTGTCTCCTTTTTATAGATTAGTTTGTCTTTAAATTATGACCAAAAAATATTTTGCTATTTCTTTCTTTATATATGGACATCTTTTCTGTAAACTTCTTTGCCTGGTTTCATCCTCATTAGTAAAAAAAATAAACACTTTTT