Transcript asmbl_21356

Sequence
Transcript Sequence for observation asmbl_21356 of TGE0004254:
GCTGGAACAAAGGTGCCATATGCTGCGGTTCCTGTAACGACAGACGATCAGCTGCCATCTGTCTTCTGGAGGTCACCCCTCTAGGGTCTCTGGGGAACAATGGGAGTCTTGGGCTTCCTCACACTGGAAGCGAACGGCCCCATGCTGACAGTGGCCCTGTCTGTGGTCCTCTTGGCTCTCCTGAAATGGTACTCTACGTCAGCCTTTTCAAGACTGGAGAAGTTGGGCATCAGACATCCCAAGCCTTGTCCTTTTATTGGAAACTTGACATTTTTCCGCCAGGGCTTCTGGGAAAGTCAGATGGAGCTCAGAAAGCTGTATGGACCTCTGTGTGGGTACTATCTTGGCCGTCGGATGTTTATCGTTATCTCCAAACCGGACATGATCAAGCAGGTGTTGGTCGAGAACTTCAGTAACTTTACCAACAGAATGGCATCGGGTTTGGAATCCAAACCGGTAGCAGACAGCGTGCTGTTTTTACGTGACAAAAGATGGGAAGAGGTCAGAAGTGTTCTAACTTCTGCTTTCAGTCCTGAGAAGCTGCATGAGATGATTCCTCTAATCAACCAAGCCTGCGACCTTCTCCTGACTCATTTAAAACACGATGCGGAACGTGGAGACGCTGTCGACATCCAGAGGTGCTACAGCTGCTACAGCACAGATGTGGTGGCCAGTGTCGCCTTCGGCACCCAGGTGGACTCCCGAAAGGCTCCTGAGGACCCCTTTGTCAAGTACTGCAGGCGTTTCTTTGCCTTCGGCATCCCCAGACCTCTCCTGGTTTTCATCGTATCATTTCCATCCATAATGGTCCCACTGGCCCGGATTTTGCCCAATAAGAACCGAGATGAACTGAATGGCTTTTTTAACAAACTCATTAGGAATGTGATTGCCTTGCGGGACCAGCAAGCAGCAGAAGAGAGGCGGAGAGACTTCCTCCAAATGGTCCTGGATGCCCGACAATCCACCCCTTCCGTGGGCGTGGAGAGCTTCGACATAGTCAGACAAGTCTTCTCATCCTCCGAATGCTCAGCGAATCCTTCCCAGCAAGGCCAGCCCAGACCCCTGTCCAAGCCCTTGACTGTGGATGAGATCGTGGGCCAGGCCTTCCTCTTCCTCATCGCCGGCTACGAGATCATCACCAACACACTATCTTTCGCCACCTACCTACTGGCCACCAACCCTGACTGCCAAGAGAAGCTTCTGACAGAGGTGGACCGTTTCAACGAGAAATATGCGACCCCCGAGCTCTGCAGCCTCCAGGAAGGCCTGCCCTACCTGGACATGGTGATCGCAGAGACCTTGAGGATGTACCCGCCAGCTTTCAGGTTCACGCGGGAGGCGGCAAAGGACTGCGAAGTGCTGGGGCAGCGCATCCCCGCCGGCACCGTGGTGGAGATGGCCGTGGGCGCCCTGCACCGCGACCCGGAGCACTGGCCCCGCCCCGAGGCCTTCGACCCGGAGAGGTTCACGGCGGAGGCCCAGCGGCGCCGGCGGCCCTTCACCTACCTGCCATTTGGAGCGGGGCCCCGGAGCTGCCTCGGCGTGAGGCTGGGGCTGCTGGAGGTCAAGCTGACGCTGCTCCACGTCTTCCGGAAGTTCCGGTTCAAAGTCTGCCCCGAGACTCAGGTGCCACTGCAGCTAGAATCCAAATCTGCCCTAGGTCCGAAAAATGGTGTCTACATCAAGATTGTCTCCCGCTGACAGTTAAGAGGGCACCCCCTAATTCGAGGAAAACTTTCATGTGGAAATTCAGATATTTGGGGAGACATCACCTTAGCCATTGAAAGGGTGTCTGGAATGCAAGTATACAAGAAGTCATTTACATAACATGTCCTAAATGCTTAATAAATGTTTGCTGCACTTA