Transcript asmbl_21256

Sequence
Transcript Sequence for observation asmbl_21256 of TGE0004232:
GACACTGTAGCCTCAGTCGAGAATCACTCAGATTCACTATCCACTGGTGAACAGGCGGATCCAGCCATAGCCAAACCAAGCATCGTAACAACCAGTGATACGGTCAGTGCAAACACAAAGATGGCACCCAGCGACTCGGAAAAATCGGGGATACCAGCCTCAGACAAGAATATTGCCATTGCTACTGGCTCAAAGACGACTCAAGATCCAGCTCAGAAGTCTATTACACCAACTACTGTCCTGATGAAGACCGAAACCAAAAGCAGCCAGGATGGACTTAAAACTGCACCTGGAACGAAAGTCCAAAGTAGTCCCAGTGTTACTGCGAGCATGACCACGCAGGGAGGTCGCACGGACCTCCAATCTACACAACATCTGAGTAGCTCCACAGACAACAGTCCTGCCCTTTCTTCCTTGACCACCCCAGCGAGCACACAACAGCTGACTCCAGGCTCTCCCAAGGGACCAGACCAAATGACGACAGCTTCAAGTAGTTCAGGCACAACGGCAGGTTACACCTTCACCCCTTCACATCCGAGGACGGCTACCACACTGAGATCATCGATTACCTCGCAAGATCTGCCGACCCCCAGCAAGATGCCAGCCATCACTGGGAACCATTCCTCCACCCCGGGGACCCCTTCCTCCATCCCTGGGATAGCGACTTCTTTGTCCAACACTCTGCAGCCTACGTCTTCATCGGGACCTGTGGCCACATCTTCTGGCGGAACCACAAGCTTCCGTACTCAGTTGGCTCCAACTGCCCCCCAAGACTCCAACATCTCTACTCCCCCCTCGGTTTTCGAGGATGACAGGATAACCTGCACGAAGACCGACCGAAGTCTGAACGAGTCGATGCTCATCTTGAACCTCACGAAAACCGTCCACTGCGCGGGGAGCCCTCTGGATGACAAACTGGTCACACTTCTGTGCCGAGCGGCTAAATCTGCCTTGAACCCAACTCAAGACCAGTGCCACATACATCTGATAGTCAGTTCAGAAGGCCAGGCAGTGGCAGTCGAAGAGATCACTATTCGAACAAAACTCGTTCTTAAGGACGTATATGAATCGCTGAAAGACAAATGGGATGACCTGAAGGAGATGGGAGTCAATGACATGAAGCTTGAGGGTCAAGGACCACCAGATGAGACTGAGGACCGGTTCAGCAAAAAATATTGTCTGCATGGCATCCTTTCTGCTCCTCGTGGCGGCCCTCTATGGCTGCTGCCACCAGCGCCTCTCCCAGAGGAAGGACCAGCAACGACTAACGGAGGAGCTGCAGACCGTGGAGAATGGTTACCATGACAACCCAACACTGGAAGTGATGGAGACCTCATCAGAGATGCAGGAGAAAAAGGTGGTCAACCTTAACGGGGAGCTGGGAGACAGCTGGATCGTCCCCCTGGACAACCTGACCAAGGATGACCTAGATGAGGAGGAAGACACACACCTCTAATCCGGTCTGCTGGCGGCCTCCGACGGTGCCACAGAGCTCCAGACCGGACCACCTCAAGTGCCATTGGGACAGGGGAGGAAAGTCCTTCCCATTTGAGGGAAAGACTGGGGAGGGAGCAGACTTGGAGGGTTCCCTCCTCCTAATCCCGCAAAGGGCCTTAATTTTTCTCTTTCAAACTGAACAAATCATATCCTGTCTAGATTCCTCTTGTAAAATAACCTACTAGTGCCTGAGCTCAGTGCTGCTGGAAGATGAGAGAGAGGAAGGGAAACCAAGAGTGAGCCATACTGGGGACGTAGAGATCAGCTAGTCGAATCCCTTCATTTCACAGATGAGATGACTGAAGCCCGAAGAGGGTAAAGTCAAGGGTGACACAGCCACTTGGTGACAGAGTCAGGATGAAAACAGATTCCTTCCTGCAGGCCAGTGCTCGTTCCACCCTGCCACACTGCTGCGATCCCTCGTGCCCTCCCTCCAGAGCTGCCCCGGGCTGGGGGTGGAGCTGCCAGATGATGGATGGGACAGAAGGGAGAGCAGCGGGGCCCGATCCTGCCTCAGCGGGATCTGGTTCCTTGAAAGCATAGGTCCCAGTTCTGTCTCCTACCCCAGCCTCGTCTGCCATTGTTCTCGTCCCCTTTGTTCTTCCCCTTCCATTCACTCGATTTTTATTCCCATTCTGCCCCAGGATCTTGAGACTAACACAGGTCATTCATGACCTTGAACCCCTTGTCTGGATTCTGGTTTCCTGCCATTTGCTTAGTGAGACTGGGACTTGGACCACACGAGACTCCCAGCGTGAACGAGGTCTGCTTAGGGGTCCGTCTACAGGTGGAGAGCTGGGGAAGCCCTTCCTCCCCGGGTGTGTCCTGGCCCATCACCCAAGGGACTCCCTGAAGAGGCTTCCCAAGTGTTCCATTGGCCTCTCTTCCCCACCAGGGGCTAAATTCCACAGCTAATGAAGGCAAAGGGTTCCTATACTGTTGTTCACTGCTCAGCCAACGGGGGTGAAAATCCCAGCTAGGAAACCCCAAGATTAGCGCGAATGGGCGGCATTCGGACAGACTTTCCCAGGGCCCCAGTCAGCAGAGAGGGCGTCTTGACAGACAATCGAAGGAAGGCCGGGGAGGCTAGGCTCTTCTATTTCATAGGAAACTCAGGGACTTTTCAAGTTGCTGAGAGTTTTGTTATGTTTTCTAACCCAGCCCTCTACTGCCTAAGGCCAAAGCTCAAATTGTAGAGACTTTCAGTGAGCTAAACTCACTGATTAGAGTCTCCTGTGCCATAGGGCAAGAGAGGCCTAGAACATGAGGTGCATTTTAAGGTGCATAACGGGCAGCCCGGGGGCATGGCCGTCTGTCTGTTCTCGGTAACCCCTCACTGTCCTGGCATGGAGCCATGTCCTCTTCTCTGTAGTCCTAGTGGGGCTGCCCTGTTGTCCTGCAGTTTCTGGTAGCATCTCAGGGAAATAAAATACTATCTGTTCCTCAGTAGAGGAGATCTGAGGGGCTCAGCAGTTAGCCACCATGTAGGAAGACTAGGCGTGGTGAGGTTTAATCTGATTTTCTGACGAGAGAATCCTGTGTGGGATTTTGAACTTTGCCCATGGTCACTATTGTTCCTGGGCGTAAGATCCCTGGAATTAACTAGGAAGATGGGCAGCACTGCTTAGGAGAGTGAAAACTGTCATTTCGGGCCAAGAGTCAGAACCCCAGAATGCAGAGGGATGGTTCTGATGACATAGGCTCTCAGATTTGGGATAGATTCTTTTATTAAAAGGGGAGGAGTTTAAGGGGAAGATCTGTGTCCCTCCGTGGCTGCCTGATTCCTTCTTCATAGCTTCTCGCCCGTTGGCTTTGGGGTTCAAGTAGGGGCCCCAGTGAATTTCTCAAGAGTTAGAGAGATACAAAGCTAACAAGGATCCAAAAGCATTCGCCCTGGTTCTCTAGCATGTGGAGGTTGGCAGGATGGAGAACAGTGCCAGTTTGGGGGAAAAGGAAGGATATCTTGTCATGTTGGGAAAAGATCTGGTCACTTCCTTCCTGTCCCGTATTTGGTTCTTTCTATCATGGTGTCTGTGGGAAAGGCCAGGCCGGATTACGGCTCCTATGCTGATTCTGCGTAACATTTCACCAGCCAGGCCTTGAGACCGAGGTAGCAAATATGCCTCTGCAAACTGATCAAAGGTCGCAACCTGTAGGCCTCTTGGGGAGATAGACAATGCCTGGAATGACTGTGGCTCTAAGGAGACCTCTGAGAAGCACTGGGCTGGTTCAGAGGTTCCTTCTTGAGGTCCATCCACATTGTGTTACTCTAGCTTTTTAGGGCAACTTCAGAATCCAATACCTTGCCTCGGCTTGTTCTTGCCACTAGACATCTATGTCAAAGGCCACAGAGCCATGCATCTGCAAAGGACATCTTCTTCCCATCTTTCTACTGGTTTCTAAATGCTGTCAGGTAATTCAGATTCTGGGGCTGAGAAGAGAGAAGAGGAATACCGGCCACTCAGCATGACTTTGAACAAGTTATACCAAAGAGATGATAAACTCTTTACTTCAGTGACACACTGGTTTTCCTAAGCTGCACAAAAGGCTAGAAACCATGCCTCTGATGACTGGACAAAATCCAGTGGGAAACATGCTGTCATAAGCGGGGGGAGAAGCAGCAATGCTTACGAAGGAGGCACAGAAATATGCTTTGCATCGTAAGACAGGATACGGGTTTAATCTAGACACAAGGTTCTTTTTCCCCCCTTTGGTAAGGAAAGTTGGCAGAAAGTTCATTTAAACCACTTCCAAGATTTATCCTTTTTGACAATATGCTGGAGAAACTTTGAAAAATAAGTTCGAGCTGATACATATATACGTATTTTTTGATAATGTAAATAAAAGTCACATATTAATCCACCCTGTACTGCTTTAAGTGAATATACTTTGGAAAAACATTTGTTAGCTAAGAGAGATGGCTTTAAAAACAAAAACAAAACAGGAATGTAAATGTCTATTTTACTAGAAATGACAAGTTTTTTTATTTTTCTTTAATGAAAAACGAAATTTAAGATAGGCTGATGACAAAGTATTTGTCTTGAGTAATGGGCATTTTTAAGTATGATCCTCATCCTTCCCCGGCAAAGTCCCAGCCTATTATAGTAAGGGTTGGAGTCAGTATACACTCATTGGAAAGTGACATTCTAGTCATAGGGAGAGGGTGTTAGAGACCTAGTCCAATATTTTTCTTTAAAGAGAAAACCTGAAGCCCAGAAAGATAAGTGACTTGGCCAAAATCATGTGGTTAGCGACAGAAACCGGATTAAAACATGTGCTGGAAGACTGTCCAGTGTCGTGTGCCTCAGAACCAAATTAAAGACAGGCACCAGAATGACACAGAGGGCTGAATTCCCTTCTCAAATCCTATCTTGCAGCAAGGCTAGGGAGGGCATGAAGACAAAAACAGAAACCTTACTGGTCTTCCACATTCTGAGTTATTTAGGTCTAAGACTTAAATGAACAATTCTGTTGGGGGAAAAAGAAAGTTTTGAATGAGCTTTTATATGATCTGCTACTAGCAGGACTAAGGATCCAGAGGAACAAGACAGGGGAAGGCAGAGGGACAAGAGTAAAGCAAAGGCATCTCTTTCATCATTGTCACCAGCTGATTCACTGAGGTTTGGTGAAAACCCAACACTGGGTGAAAGAAGGCGATTATCACTTGATGTGGGTCTTTTCTGTTATTCGTGAATTTTAAGCAGTTTGCCCAGGAGACTGGGGTGGG