Transcript asmbl_47236

Sequence
Transcript Sequence for observation asmbl_47236 of TGE0002382:
GGGCTCGGAGGCGGAAGCTTGAGGGGCGCGGGGAGGAGCTTCGCGTGCGGGGTGAACGCCCGCTCTACGTGCTCGTTCTCTTCGCGACCGCTGCGCGCGAGCCCCGTGTCCCCACGGCGGGCAGCAGCGGCGGCGGCGGCGGCTGAACGCGGAGGGGGCGGAGGGAGCCCGCGGCGGCGGCAGCAGCTACAGCGAAATGGCGGAGACCGTGGCTGACACCCGGCGGCTGATCACCAAGCCGCAGAACCTGAATGACGCCTACGGACCCCCCAGCAACTTCCTCGAGATCGATGTGAGCAACCCGCAAACGGTGGGGGTCGGCCGGGGCCGCTTCACCACTTACGAAATCAGGGTCAAGACAAATCTTCCTATTTTCAAGCTGAAAGAATCTACTGTTAGAAGAAGATACAGTGACTTTGAATGGCTGCGAAGTGAATTAGAAAGAGAGAGCAAGGTCGTAGTTCCCCCGCTCCCTGGGAAAGCGTTTTTGCGTCAGCTTCCTTTTAGAGGAGATGATGGAATATTTGATGACAATTTTATTGAGGAAAGAAAACAAGGGCTGGAGCAGTTTATAAACAAGGTCGCTGGTCATCCTCTGGCACAGAACGAACGTTGTCTTCACATGTTTTTACAAGATGAAATAATAGATAAAAGCTATACTCCATCTAAAATAAGACATGCCTGAAATTTGGCAAGAAGGGGCAAAAACGTGACTATTAATGATTGATAAGCACCAGTGAAGAAGTTCTAACTTTTAGCATGCTGCACAGAAACTGGTATAACATGCCTTCAGTATACTAACACTCATATGCTCAGTTTTGTTTTGTTTTGGCAGTTGACAAGAAGTTAATTTGCTTTAGTAAAAATCCCTCATTCCAGCCTTTCTATATAAATAGCTCTTTCTTGCTGTTTTAATGTGGTGCACACTATAGCCTCACAAACCTGTTATTCCAGTGTAATCTGCAGTGTCGTAACTAAAGTTACTGGCTTGGTCTTATTTGCACAGTTTTTGCGTCTTGTTTGCTTCTTGCATCTGATTAACTAGAATATTTCTCTTTCCCCCTTTTAATTTGTGATGTCACTTGACCCCATTTATGTGTAGGAGCACTACACCATTGGTTTCCAATACTGCACACATAAGATACATACTTGTGTGCAGAAAGTATCTTCCTCCAGGCTTGTAATACCCTTCACATGGAAGATTAATGAGGGAAATCTTTATATTCTGTATAAAAACAAAAGCAAATTTATATACTAAAATCATTTGTCTAAAAATTTAAGTTGTTTTCAAATAAAAATTAAAATGCATTTCTGATATGCACTGATTGTGTTGCCTCCAGC