Transcript asmbl_20443

Sequence
Transcript Sequence for observation asmbl_20443 of TGE0004192:
GGTTGCGCTGCGGAGCGCAGCTGTGAGGGAGTCTGTCTGGTCCGCGGCCCCAGAACCCGAGCTGAAGCGGTAGCGCAGGCTGCGGGAAGCTGAGTCGGAAGGCCTGAGTGTTTGTTCAAGCATGTCGGAAGGGGAGTCCCAGACAGTACTCAGCAGTGGCTCAGACACAAAGGTAGAATCCTCATCTTCAGCTCCTGGCCTGACATCAGTGTCACCTCCTGTGACCTCCACAACCTCAGCTGCTTCCCCAGAGGAAGAAGAAGAAAGTGAAGATGAGTCTGAGATCTTGGAAGAGTCACCCTGTGGGCGCTGGCAGAAGAGGCGAGAAGAGGTAAATCAGCGGAATGTACCAGGTATTGACAGTGCATACCTGGCCATGGATACAGAGGAGGGTGTAGAGGTTGTGTGGAATGAGGTACAATTCTCTGAGCGCAAGAACTACAAGCTGCAGGAGGAAAAGGTCCGTGCTGTATTCGATAATCTGATTCAATTGGAACATCTCAACATTGTTAAGTTTCACAAATATTGGGCTGACATTAAAGAGAACAAGGCCAGGGTCATTTTTATCACAGAATACATGTCATCTGGGAGTCTTAAGCAATTTTTGAAGAAGACCAAAAAAAACCACAAGACTATGAATGAAAAGGCTTGGAAGCGCTGGTGCACACAGATCCTCTCTGCCCTAAGCTACCTGCACTCCTGTGACCCCCCCATCATCCATGGGAACCTGACCTGTGACACCATCTTCATCCAGCACAACGGACTCATCAAGATTGGCTCTGTGGCTCCTGACACTATCAACAATCATGTGAAGACTTGTCGGGAAGAACAGAAGAATCTACACTTCTTTGCACCAGAGTATGGAGAAGTCACTAATGTGACAACGGCAGTGGACATCTATTCCTTTGGCATGTGTGCACTGGAGATGGCAGTGCTGGAGATTCAGGGCAATGGAGAGTCCTCATATGTGCCACAGGAAGCCATCAGCAGTGCCATCCAGCTTCTAGAAGACCCATTACAGAGGGAGTTCATTCAAAAGTGCCTGCAGTCTGAGCCTGCTCGCAGACCAACAGCCAGAGAACTTCTGTTCCACCCAGCACTGTTTGAAGTGCCCTCACTCAAACTTCTTGCTGCCCACTGCATTGTGGGACACCAACATATGATCCCAGAGAATGCGCTGGAGGAGATCACCAAAAACATGGATACCAGTGCTGTACTGGCTGAAATCCCTGCTGGACCAGGAAGAGAACCAGTTCAGACTTTGTACTCTCAGTCACCAGCTCTGGAATTAGATAAATTCCTTGAAGATGTCAGGAATGGGATCTACCCCCTGACAGCCTTTGGGCTGCCTCGGCCCCAACAGCCACAGCAGGAGGAGGTGACATCACCTGTGGTGCCGCCTTCTGTCAAGACTCCAACACCTGAACCAGCTGAGGTGGAGACCCGAAAGGTGGTGCTGATGCAATGCAACATTGAGTCAGTGGAGGAGGGAGTCAAACACCACCTAACACTTCTGCTGAAGCTGGAGGACAAACTGAACCGGCACCTGAGCTGTGACCTGATGCCAAATGAGAACATCCCTGAGTTGGCAGCTGAGCTGGTGCAGCTGGGCTTCATAAGTGAGGCTGACCAGAGCCGGCTGACTTCTCTGCTAGAAGAGACCCTGAACAAGTTCAATTTTGCCAGGAACAGCACCCTCAACTCAGCCGCTGTCACCGTCTCCTCTTAGAGCTCACTTGGGCCAGGCCTCTAATCTGAGCTGTGGCTGTCACTAGATATGCTGCAGCCTTCCTGCCCCTCCCCCCCAGTCAGTATTACCCTGTGAAGCCCCTTCTCTCCTTTATTATTCAGGAGGGCTTTGGGGCTCCCTGGTTCTGAGCATCACCCTACCCCTTCCCCTTTTATTCCTCCCCTCAGCACTTTGTTTACTTGTTTTGCACAGACGGGGGCCTGGGCCTTCTCAGCAGCCGCCTTCTAGTTGGGGGCTAGTAGCTGATCTGCCGGCTCCTGGCCTGCCTGTGTGGAAAGGGGGCCCACGGGCGCTGGGGGAGCCGAATTCTACAATCCCGCTGGGGCGGACGGGGCGGGAGAGAAGGGTGGTGCTGCAGTGGTGGCCCTAGGGGGCCATTCTGATTCGCC