Transcript asmbl_20249

Sequence
Transcript Sequence for observation asmbl_20249 of TGE0004164:
ATTCCCACACCCACCCACCCACTTAGTGTATTAGGGTCCTAGCTGGGTTTCTCTGAGAGTGGGGACTTATGCCTCCCTCCCCTCTGGGGGAGGGAGGAATAGAAAGTCCCTCATCTCTTTGCTCGCCTAAGTAGAGACTGGTATCTCTTCTAAAGGGTGAGGTGGCTTTGAACCCGGGTTGCCCGGCCAGCGCGACCAAGGAGGTGGCTGGAGGACTGGAGAATGAACGGAGAAGCCGACTGTCCCACAGACCTGGAAATGGCCGCCCCCAAAGGCCAAGACCGCTGGTCCCAGGAAGACATGCTGACTTTGCTAGAATGCATGAAGAACAACCTTCCATCCAATGACAGCTCCAAGTTCAAAACCACTGAGTCACATATGGACTGGGAAAAAGTAGCATTTAAAGACTTTTCTGGAGACATGTGCAAGCTCAAATGGGTAGAGATTTCTAATGAGGTAAGGAAGTTCCGTACATTGACAGAATTGATCCTTGATGCTCAGGAACATGTTAAAAATCCTTACAAAGGCAAAAAACTCAAGAAACACCCGGACTTCCCAAAGAAGCCCCTGACCCCTTATTTCCGCTTCTTCATGGAGAAGCGGGCCAAGTATGCTAAACTCCACCCTGAGATGAGCAACCTGGACCTGACCAAGATCCTGTCCAAGAAATACAAGGAGCTGCCGGAGAAGAAGAAGATGAAATATATTCAGGACTTCCAGAGGGAGAAACAGGAGTTCGAGCGAAACCTGGCCCGATTCAGGGAGGATCACCCTGACCTAATCCAGAATGCCAAGAAGTCGGACATCCCCGAGAAGCCCAAAACCCCCCAGCAGCTGTGGTATACCCACGAGAAGAAAGTGTATCTCAAAGTGCGGCCAGATGCCACTACGAAGGAGGTGAAGGACTCCCTGGGGAAGCAGTGGTCTCAGCTCTCGGACAAAAAGAGGCTGAAATGGATTCATAAGGCCCTGGAGCAGCGGAAGGAGTACGAGGAGATTATGCGTGACTATATCCAGAAGCACCCTGAGCTGAACATCAGTGAGGAGGGCATCACCAAGTCCACCCTCACCAAGGCCGAACGCCAGCTCAAGGACAAGTTTGATGGGCGACCCACCAAGCCACCTCCGAACAGCTACTCGCTGTACTGTGCAGAGCTGATGGCCAACATGAAGGATGTGCCCAGCACAGAGCGCATGGTGCTATGCAGCCAGCAGTGGAAGCTGCTCTCCCAGAAGGAGAAGGATGCCTACCACAAGAAGTGTGACCAGAAAAAGAAGGATTATGAGGTGGAACTGCTCCGTTTTCTGGAGAGCCTGCCTGAGGAGGAGCAGCAGCGGGTGTTGGGAGAGGAGAAGATGCTGAACATCAATAAGAAGCAAGCAACCAGCCCAGCCTCCAAGAAGCCCTCCCAGGAAGGGGGCAAGGGTGGCTCAGAGAAGCCCAAGAGGCCCGTGTCGGCCATGTTTATCTTCTCTGAGGAGAAGCGGCGGCAGCTGCAAGAGGAACGGCCAGAGCTCTCAGAGAGCGAGCTGACCCGCCTGCTGGCCCGCATGTGGAACGACTTATCGGAGAAAAAGAAGGCCAAATACAAGGCTCGGGAGGCTGCGCTGAAGGCCCAGTCGGAAAGGAAGCCTGGCGGAGAGCGCGAGGAACGGGGCAAACTGCCCGAGTCACCCAAGAGAGCAGAGGAGATCTGGCAACAGAGTGTCATTGGCGACTACCTGGCTCGCTTCAAGAATGACCGGGTGAAGGCCTTGAAAGCCATGGAGATGACCTGGAACAACATGGAGAAGAAGGAGAAACTGATGTGGATTAAGAAGGCGGCAGAAGACCAAAAGCGATATGAGAGAGAGCTGAGTGAGATGCGGGCACCTCCGGCTGCTGCAAACTCATCCAAGAAGATGAAGTTCCAGGGAGAACCCAAGAAGCCTCCCATGAACGGTTACCAGAAGTTCTCCCAGGAGCTGCTGTCCAACGGGGAGCTGAACCACCTGCCGCTGAAGGAACGCATGGTAGAGATTGGCAGCCGCTGGCAGCGCATCTCTCAGAGCCAGAAAGAGCACTACAAAAAGTTGGCAGAGGAGCAGCAAAAGCAATACAAAGTGCACCTCGACCTCTGGGTCAAGAGTCTGTCTCCCCAGGACCGAGCAGCATATAAAGAATATATCTCCAATAAACGTAAGAGCATGACTAAGCTGCGAGGCCCAAACCCCAAGTCCAGCCGGACTACCCTGCAGTCCAAGTCGGAGTCTGAGGAGGAGGATGACGAGGATGAGGATGATGATGACGAGGATGAAGAGGAAGAAGATGATGAGAATGGAGACTCCTCTGAGGATGGCGGGGACTCCTCTGAGTCTAGCAGCGAGGATGAGAGCGAGGACGGGGATGAGAATGAGGATGACGATGAGGATGATGATGAGGATGATGATGAGGATGAGGATGAAGACAATGAGTCCGAGGCCAGCAGCTCCAGCTCTTCCTCCTCAGGGGACTCCTCAGACTCTGACTCCAACTGAGGCTGGGCCCCACCCGGGGCTCCCCTCCCCAACTGACCACCTTTGTTTCTCCCCCTTGTTCTGTCCCCTGCCCATGACCCACCCACCCCACTCCCCACCTCCTCCAATTTTTCTTTCTTTTTTTTTTAAACAATATGGTGGGGGAGGGGCTGGAGGAGCTCAGGCCAGGACTCTGCAGCCTCAGAGACATCAGCCCTGGGGGCCCTCCAGGGAGCAACCATCAGACTGAGCCACCACTGGACCGGCCCAGCCCACCCCTCTGCACTTGCGGTTCTGGCATGGACAATGGACCTGGGAGTGGGGTGGGGGGGTTCCCAAAGAGTTCAGTGAGGCCCGCTACACCTGCAGCCCAACCCAAGGGAGGGTGGAAGCTTGGGGAGGACCCCTGCCTTCCCAGAGAGGCTTGCCACCTGGACCCCTACATTGGAACTGGAGGCAGGGAACCTGGGGAGAGGAGGATGGGTGCCTATGAGAAAACAGGCGCTGCCCCATAGACCTCTCCCCTGCCCCCTGCAGGAAGGAACTGCCTGGACCCAGTCATGGGGGGAGGGGCAGAAGTGTTTTTTATATATGTGTATATATTTTTTTTTTAAGCTCTGAGCTGTCAACGAGACGTTTCCTACCGATATCGGCTGCCGTCT