Transcript asmbl_19628

Sequence
Transcript Sequence for observation asmbl_19628 of TGE0004149:
AAGCAGGGTGCGGGGCGGTCGGGGGGGGACCCGCCGCGGCTGTTGCCACCGCCGCCACCACCGCCTCTGTGCTCGTGGCGTGGGAAAGGAGGCGTGAGTCCCGGGCGCGAGCCGCCGGCGGCGCCGCTACGGGAGGATCGGTGGTGGGAAGGCGATGGCGGATATAGATAAACTCAATATCGACAGCATCATCCAACGGCTGCTGGAAGTGAGAGGGTCCAAGCCTGGTAAGAATGTCCAGCTACAGGAGAATGAAATCAGAGGATTGTGCTTAAAGTCCCGAGAGATCTTTCTCAGTCAGCCTATCCTACTAGAACTTGAAGCACCACTCAAAATATGTGGTGATATCCATGGGCAGTACTATGATTTGCTTCGACTTTTTGAGTACGGTGGTTTCCCACCCGAAAGCAACTACCTGTTTCTTGGGGACTATGTGGACAGGGGGAAGCAGTCATTGGAGACTATCTGCCTTTTATTGGCGTACAAAATCAAATATCCCGAGAATTTTTTTCTTCTCAGAGGAAACCATGAATGTGCCAGCATCAATAGAATTTATGGATTTTACGATGAATGTAAAAGAAGATATAACATTAAACTATGGAAAACTTTCACAGACTGCTTTAATTGTTTACCAATAGCAGCCATCGTGGATGAGAAAATATTTTGCTGTCATGGAGGTTTATCACCAGATCTTCAATCTATGGAGCAGATTCGGCGAATTATGCGACCAACTGATGTACCAGATCAAGGTCTTCTTTGTGATCTTTTGTGGTCTGACCCCGATAAAGATGTCTTAGGCTGGGGTGAAAATGACAGAGGAGTGTCCTTCACATTTGGTGCAGAAGTGGTTGCAAAATTTCTCCATAAGCATGATTTGGATCTTATATGTAGAGCCCATCAGGTGGTTGAAGATGGATATGAATTTTTTGCAAAGAGGCAGTTGGTCACTCTGTTTTCTGCACCCAATTATTGTGGAGAGTTTGACAATGCAGGTGCCATGATGAGTGTGGACGAAACACTAATGTGTTCTTTTCAGATTTTAAAGCCTGCAGAGAAAAAGAAGCCGAATGCCACAAGACCTGTAACACCTCCAAGGGGTATGATCACAAAGCAAGCAAAGAAATAGATGTCATTTTGACACTGCCTAGTTGGGACTTGTAACATATAGTATATAACCTTCATTTTTAAAACTGTAATGTGTATTGGTCAGCTTGCTCAAACAGTGTGTTTGTGGGGCCCTCCCTTCCATTTTTGACTTAATGAATGGCATTTGCTGGTTATAACAGCAAATGAAAGATTCTCTACTCCCAAGAAACAATATTTTGTTTTTAATTCTCTATTCCTTTTACAAACAATTTTAATGATGGTGTTAAAGCTGTATGCCCCAGGATGGTTTATCCTGTCTGAGGGGTAAGTGTACAATTGACCTTTTTTTTTTAATTCAGTACAGCCCATGAATCATGTAAATGCTCGTTTTCTTTAGGATATAAAGAGAGCCCTAGGGTGCTCAATCTGTACATGTTATCGTCATAAAATGCATACTGTTGATACAGACCACTGTGAACATTTTTTTAATTTTAAGATTTTGTTTCAAAGGGATTGCTTATTTCTCTCATTGTCTTGTCATGTACAAATTGGTTTTTATTGCTATCAACATTAGAAGTAACTTTCAACCTTGCCAGCATCACTGGTATAATGTATGTTTAATTAAAGCACACTTTCCTCTACCGAATACTTAAAACGAGAATTAAAGCCATTATTTTAAATGTTTGTGACTCTTTCCTAAAGCCAAAGTTTCTGTTGAAATACGTATTGACACACCCCTAAGAACAAAATGGCATAGTTTTATACCCATGCCGCCTTGTTGGGGATTCAAAAACAGGTTTTTGAGTTAAAATAGCAATTAGTAATATAGTGCAGTTTAAGCTATTAATGATTAAAGTTAATAACATTTTGTACAATTTCCATATAGTCTATTCATTAATCTTTTTACAGTTGCATCAGGCCTGAACCCGTCCATTCAGAAAGCTTCAAATTATAGAAACAATACTGTTCTATACGAGTGACCGATTATGCTTTCTTTGGCCTACACTCTTTATTCTGCGGTGAAATTGAGGCTTATAAGTCAAACAAAGGAACTAACTTACTATCCACCAGTTTATACAGAACTCACAGTATCTATGACTTTTTTAAAACTAAGATCTGTTAAAAAGAAATCTGTTTCAACAGATGACCGTGTATAATACCATGTGGTGAAAGTGAATTCAGACTTATTAAATGATGAACTTGTTAAATCCTCTCAGTGTCTATTTATCAGCACAATACACACAGGAGAACTGTTGATGGCATATTAAATCGATTTTAATGAATAAATGGCTCTGGAAACCACACAGTTTCAA