Transcript asmbl_13952

Sequence
Transcript Sequence for observation asmbl_13952 of TGE0000232:
CCCAAAACAAACAACCCCCAAGCAGACCTTAGCTGGATCTCCAAAATACAAGTGAATCACCCGGCAGTTCTGAGGCGTGCGGAACAAATCCAGGCTCGCAGAACCGTGAAAAAGGAGTGGCAGGCTGCTTGGCTCCTGAAAGCTGTTACCTTTATAGATCTTACTACACTTTCAGGTGATGATACATCTTCCAACATTCAAAGGCTCTGTTATAAAGCCAAATACCCAATCCGGGAAGATCTCTTAAAAGCTTTAAATATGCATGATAAAGGCATTACTACAGCCGCCGTTTGTGTTTATCCCGCCCGGGTGTGTGATGCTGTAAAAGCACTCAAGGCTGCAGGCTGTAATATCCCTGTGGCATCAGTGGCCGCTGGATTTCCAGCTGGACAGACTCATTTGAAGACACGATTAGAAGAGATCAGATTGGCTGTGGAAGATGGAGCTACAGAAATCGACGTGGTAATTAACAGAAGCTTGGTGCTGACAGGCCAGTGGGAAGCCCTGTATGATGAGATTCGTCAGTTTCGCAAGGCCTGTGGGGAGGCTCATCTTAAAACTATATTAGCGACAGGAGAACTTGGAACTCTTACTAATGTCTATAAAGCCAGTATGATAGCAATGATGGCAGGATCAGATTTTATTAAGACCTCTACTGGAAAAGAAACAGTAAATGCCACCTTCCCGGTAGCTATAGTAATGCTGCGGGCCATTAGAGATTTCTTCTGGAAAACTGGAAACAAGATAGGGTTTAAACCAGCAGGAGGCATCCGCAGTGCAAAGGATTCCCTTGCTTGGCTCTCTCTTGTAAAGGAGGAGCTTGGAGATGAGTGGCTGAAGCCAGAACTCTTTCGAATAGGTGCCAGTACTCTGCTCTCGGACATTGAGAGGCAGATTTACCATCATGTGACTGGAAGATATGCAGCTTATCATGATCTTCCAATGTCTTAAATCAGTCACCAGTTCCAGAAAAGTTCTTTACGACAATGTTTAAAAATTATTTTTCTACGTAATTGCTAAAATTATTTAATTAAAAAATTGGGCAGTAGGTAACTGGCATTCCTCTCTTTAAAATTTCTACCGAACTTAATGGAATGGAAAAAGCAAACTCATCCACATGTGGTACTCATTTCAGGCACATCTGAAATGATCTTAATTACTAGAAGATCTGCACTATTAACTTTGTGAAGAGTTTCTCCTAAAAACTTTAAGTAAAATGTTAATGGTAGCTTTGATAACATCAAATTCTAAGGGAGAAAAAAACAATATTAAACCGCCCAAGCAGTGTGCCCTAGCAGAGGAAAATGCAACATCTCGCAAGCGCTGCTGTAACGACTTCAGGAGTCACTGATTCAGCACTAATTTCCTGCTGTGAAAACTCATCTTTCATTTTTGCCGTGGATAGGCGCTTTTATTAATTGTTGTCCTAATGAAATTTCTGACATTGTCATATACAACGATGA