Transcript asmbl_19469

Sequence
Transcript Sequence for observation asmbl_19469 of TGE0004133:
AGGCGGGAACCACTGTCCCTGGTCAACGTGCGGAAGAGGAGCCTGGAATCTGGAGACGACGACCTGCCGACCAGGATGGACCACTACAAAGCCAAGGCTACGCGGCACATCTTCCTCATCAGGCACTCGCAGTACCACGTGGACGCGTCCCTGGAGAAGGACCGCACTCTGACGCCCCTGGGTCGTGAGCAGGCTGAGTTGACTGGTCTCCGACTTGCAAGCCTGGGGTTGAAGTTTAATAAAATCGTGCATTCCTCCATGACCCGTGCGGTGGAAACCACCGACATCATCAGTAAACACCTGCCAGGTGTCTCCACGGTCAGCACAGACCTGCTGAGGGAAGGTGCCCCCATCGAGCCCGACCCGCCCGTGTCGCACTGGAAGCCGGAGGCTGTGTATTACGAGGACGGGGCCCGGATTGAGGCTGCCTTCCGCAGTTACATCCACCGGGCAGACACCAAGCAGCAGGAGGACAGTTACGAGATCTTCATCTGCCATGCCAACGTCATCCGCTACATCGTGTGCCGGGCGCTGCAGTTCCCTCCGGAAGGCTGGCTCCGTCTCTCCCTCAACAATGGCAGCATCACCCACCTGGTGGTCCGGCCTGATGGCCGAGTGGCACTCAGGGCTCTTGGGGACACGGGCTTCATGCCTCCCGACAAGATTTCCCGCTCCTGAGGCCGCTGCGAGGCCAGTGCCTGGCTCTGCTGCGGGAGCCGGGAACAAGGGCCGTGTCCCCTGCCTTCCGTCCGCAGGTGGCACTGCGGTCGCTGTTTCTCCAGGATGAGGCTGCGGAGTGGAAACACCTGCCACACGGCACATCGTCATCCTCCTGCCCAGAGTGGCAGGGGGCGCTCGGGCCCCGCTGCCGGGTCTCCCCAGGTCCTCTGCCCCAGGCTCACCTACTAGGATGGGCCTGTGGGGGTGGAGGCCCCGCGGGGCCCTGCAGGTGTGCACCGGGGCCTGTGGCCAGGACCGCGACCGCAAGAGGCAGCGAGCCCATCAGGCTGAGGGCGTCAGGAGGGCCCGGCGCTTCCATCCTAATGTCTTTGCTTCGTACGTTCTTTTTGTAAGATCCTCTCGTCACTTATGTTAAAGACTTTCCTCACCTGGGTTCTTTTCTGAAAACCGATTCCTCGCTCCGGAGTTACGCACCCCTGATGCTACTGCATCTGAACTCACGTGTCTTCAAGGCCTTTGCGGACATGGGCACCCAGGCAGGTGGTGGGGGCCAGGGGGAGAGGGTCCTGTTTAAAATATCCAGCTGATGGCTGAATCTTTGTTTGCCTCTAGCTGTTAATCTTTTATGCTTATGGATGAAAACATTTAGACACGACATGTCCATCATAAGTATTCTGTTAATTTACCAAAAACCCTACAATTTCTGCGAAGTGGTTATGGACATTTTCTGCTGTGATCAGTGCAACTGAGATATTTGATCCATTTCTGTTAACTTGGAAATAACTACAAAAT