Transcript asmbl_19421

Sequence
Transcript Sequence for observation asmbl_19421 of TGE0008449:
GAAAGAAGCTCGGAAAGGATCTCTGCTCTTTGACGACCTCCCTCCGGCCGGCAGTACTGACTCAGGATCAGGGGGACCTTTGCTTTTTGATGATCTCCCACCAGCCAGCAGTGGTGATTCAGGTTCTCTCGACACCTCGCTAGCCCAGCTGGTAAAGAATGAAGGGAAAGGAGCAAAGAGGAAAACCTCTGAGGAAGAGAAGAATGGCAGTGAAGAGCTTGTGGAAAAGAAAGTTTGTAAAGCCTCTTCAGTGATCTTCAGTTTGAAAGGCTACGTGGCCGAGCGGAAGGGCGAGCGGGAGGAGATGCAGGACGCCCACGTCATCCTGAATGACATCACCGAGGAGTGCGGGCCCCCGTCATCCCTCATTACCCGGGTTTCTTATTTTGCTGTTTTCGATGGACATGGAGGAATTAGAGCCTCAAAATTTGCTGCACAGAATTTGCATCAGAACTTAATCAGGAAATTTCCTAAAGGGGATGTAATCAGTGTAGAGAAAACCGTGAAGAGATGCCTTTTGGACACTTTTAAGCATACCGATGAAGAGTTCCTTAAACAAGCCTCAAGCCAGAAGCCTGCCTGGAAAGATGGGTCCACTGCCACGTGTGTTCTGGCTGTAGACAACACTCTTTATATTGCCAACCTCGGAGATAGCCGGGCCATCCTGTGTCGCTACAACGAGGAGAGCCAGAAGCATGCCGCCTTAAGCCTCAGCAAGGAGCACAATCCTACACAGTATGAGGAACGGATGAGAATACAGAAGGCTGGAGGGAATGTCAGGGATGGGCGTGTCTTGGGTGTGCTGGAAGTGTCCCGCTCCATTGGGGATGGGCAGTACAAGCGCTGTGGGGTCACCTCCGTGCCAGACATCAGACGCTGCCAGCTGACCCCCAATGACAGGTTCATTTTGCTGGCCTGCGACGGCCTCTTCAAGGTCTTTACCCCAGAGGAAGCTGTGAACTTCATCTTGTCTTGCCTCGAGGATGAGAAGATCCAGAGCCGGGAAGGGAAGCCCGCTGTCGACGTCCGCTACGAAGCGGCCTGCAACAGGCTGGCCAGCAAGGCAGTGCAGCGGGGCTCGGCCGACAACGTCACCGTGATGGCGGTGCGGATCGGGCCCTGAGGGCGCCGCGAGGCCGGGCCCGGTGCGGCATTGGCCAAGGTCATGTGTGTGTGCACATCTGTGTGTTTCGCGTACTCCTGTGGGACTCTCGTGGTTGTAAATAAAGGTTCTTTTTTTTTT