Transcript asmbl_47133

Sequence
Transcript Sequence for observation asmbl_47133 of TGE0002372:
GTCAGCGCGGGAGAGAGAAAGAGAGGAGCCGACTCGGCAGGGACTGGGGGACCGGGCCGAGAGTGCGAGCGAGCGAGGGAGGGAGTGAGGGAGCGTGCGAGCCAGAAGGGGAAAGGCGGCCACTCGTGCCTGAGCGACCGCAGAGGGGAGTGGGAGCAGTGGGGTAAAGGAGCGGGGGGCGGGAATAAGAAAGGCCGAGAGAAGGCGGACAGAGGCTAGTGGTGGTGGTGGTGGTAGGGGGAGAAGGAGGAGCTGGAGGAGGGCAGGGGCTGAGGGAGTGAGTGAAGCGGACGCGCGAGGGAGGGGAGGGAAGGGAAGGGAAGGGAAGGGGGGGTCACGCGGGGGCGCGCGCGCGCACCGGGAGCGCGCTCGGAGGCGAGTGGAACTGGATCGGGTTTGCTGCCAGCGGCGTGAGCTTCGGCCGCCATTTTACAACAGCTCCACTCGCGCCGGACACAGGGAGCAGCGAGCACGCGTTTCCCGCAACCCGATACCATCGGACAGGATTTCTCCGCCTCAGCCCAACGGGGAGATCTCTGGAAACATGGCTACAGAACATGTTAATGGAAATGGTACTGAAGAGCCCATGGATACTACTTCTGCAGTTATCCATTCAGAAAATTTTCAGACATTGCTTGATGCTGGTTTACCACAGAAAGTTGCTGAAAAACTAGATGAAATTTACGTTGCAGGGCTAGTTGCACATAGTGATTTAGATGAAAGAGCTATTGAAGCTTTAAAAGAATTCAATGAAGACGGTGCATTGGCAGTTCTTCAACAGTTTAAAGACAGTGATCTCTCTCATGTTCAGAACAAAAGTGCCTTTTTATGTGGAGTCATGAAGACTTACAGGCAGAGAGAAAAACAAGGGACCAAAGTAGCAGATTCTAGTAAAGGACCAGATGAGGCAAAAATTAAGGCACTCTTGGAAAGAACAGGCTACACACTTGATGTGACCACTGGACAGAGGAAGTATGGAGGACCACCTCCAGATTCCGTTTATTCAGGTCAGCAGCCTTCTGTTGGCACTGAGATATTTGTGGGAAAGATCCCAAGAGATCTATTTGAGGATGAACTTGTTCCATTATTTGAGAAAGCTGGACCTATATGGGATCTTCGTCTAATGATGGATCCACTCACTGGTCTCAATAGAGGTTATGCGTTTGTCACTTTTTGTACAAAAGAAGCAGCTCAGGAGGCTGTTAAACTGTATAATAATCATGAAATTCGTTCTGGAAAACATATTGGTGTCTGCATCTCAGTTGCCAACAATAGGCTTTTTGTGGGCTCTATTCCTAAGAGTAAAACCAAGGAACAGATTCTTGAAGAATTTAGCAAAGTAACAGAGGGTCTTACAGACGTCATTTTATACCACCAACCGGATGACAAGAAAAAAAACAGAGGCTTTTGCTTTCTTGAATATGAAGATCACAAAACAGCTGCCCAGGCAAGGCGTAGGTTAATGAGTGGTAAAGTCAAGGTCTGGGGGAATGTTGGAACTGTTGAATGGGCTGATCCTATAGAAGATCCTGATCCTGAGGTTATGGCAAAGGTAAAAGTGCTGTTTGTACGCAACCTTGCCAATACTGTAACAGAAGAGATTTTAGAAAAGGCATTTAGTCAGTTTGGGAAACTGGAACGAGTGAAGAAGTTAAAAGATTATGCGTTCATTCATTTTGATGAGCGAGATGGTGCTGTCAAGGCTATGGAAGAAATGAATGGCAAAGACTTGGAGGGAGAAAATATTGAAATTGTTTTTGCCAAGCCACCAGATCAGAAAAGGAAAGAAAGAAAAGCTCAGAGGCAAGCAGCAAAAAATCAAATGTATGACGATTACTACTATTATGGTCCACCTCATATGCCCCCTCCAACAAGAGGTCGAGGGCGTGGAGGTAGAGGTGGTTATGGATATCCTCCAGATTATTATGGATATGAAGATTATTATGATTATTATGGTTATGATTACCATAACTATCGTGGTGGATATGAAGATCCATACTATGGTTATGAAGATTTTCAAGTTGGAGCTAGAGGAAGGGGTGGTAGAGGAGCAAGGGGTGCTGCTCCATCCAGAGGTCGTGGGGCTGCTCCTCCCCGCGGTAGAGCCGGTTATTCACAGAGAGGAGGTCCTGGATCAGCAAGAGGCGTTCGAGGTGCGAGAGGAGGTGCCCAACAACAAAGAGGCCGCGGGGTACGTGGTGCGAGGGGTGGCCGCGGTGGAAATGTAGGAGGAAAGCGCAAAGCTGATGGGTACAACCAGCCAGATTCCAAGCGGCGCCAGACCAATAATCAGAACTGGGGCTCCCAACCCATTGCTCAGCAACCGCTCCAAGGTGGTGATCATTCTGGTAACTATGGTTACAAATCTGAAAACCAGGAGTTTTATCAGGATACTTTTGGGCAACAGTGGAAGTAGAAACAGTAGGGCCTCTGTAAAATTGGAGACTGATAGGTTGATCAGAAACTCACCCTAAATCTGAACGGGTGCCGCTATAATTTGTGACATCTGGCAAGATTTCCCTTTATGTATATATTTTAACAATCCGCTTGGACACGAACAAAGCCACACTTCTAACTGCTTCTGGCGAACTGATTTTATTTTTAATTTTTTTCAATAAAGATATTCTTAGATACTGAAAGAAATAGTTAATGAGTTTGCATTTGTGCTTGAGAAAATTTGGCTCAAGTCCATTTGGCTGTAGTGTCAACGATGTTTCCAGTAGTGTTTAGATTTGGTGTCTTCAAAGGTAGTTGATTAAAACCAAGTGTGTCTTTAATATCTTGTATCAGAATAACTTTGTATGTTACCAACTTAAATTGCTAGAATAAGGTAAATTGATACACAACTGCTATTTTTAATTTAGAACTTTGACCTAATTTGGGTTTTCAAAACCATTTTGGCTACTTGTATTCTTTATGCTGTTGTTTATTTCAATAAAAA