Transcript asmbl_19107

Sequence
Transcript Sequence for observation asmbl_19107 of TGE0004108:
GGGGATCTGGCTAGCGGGAAGGTGTGGCGGCGGGACCATCCGGGAAGATGCCCGTGGCCGTGATGGCAGACAGTGCCTTTAGTTTCAAAAAGCTGCTGGATCAGTGCGAGAACCAGGAGCTCGAGGCTCCTGGAGGAATTGCTACACCTCCAGTGTATGGTCAGCTTCTAGCTTTATATCTGCTCCATAATGACATGAATAATGCAAGATATCTTTGGAAAAGAATACCACCTGCTATAAAATCTGCAAATTCCGAACTTGGAGGGATTTGGTCAGTAGGACAGCGGATCTGGCAGAGAGATTTCCCTGGGATCTACACGACCATCGGCGCTCACCAGTGGTCTGAGACGGTCCAGCCAATCATGGACGCGCTTAGAGACGCAACGCGGAGACGCGCCTTCACCCTGGTCTCGCAGGCGTACACCTCCATCGTCGCCGAGGACTTCGCCGCCTTCGTTGGGCTCCCTGTGGAGGAGGCCGTGAAAGGCATATTAGAACAAGGATGGCAAGCCGACTCTACCACAAGAATGGTCACGCCCAAAAAGCCAGTCGCAGGCGCCCTGGATGTCCCCTTTCACGGGTTCGCTCCTTTATCAGAGCCAGCCCCGGTCCCGCCCATCCCCAACGAGCAGCAGCTCGCCAGACTCACCGACTACGTGGCTTTCCTCGAAAACTGACCGGTCCCGCCTCCCGGACCCACCCCGGAGCGCTGTGTCCTGAACTGATCCAGAAATGCTAAATTTTTATTTTCAGCTTATTGGATGGATTCAGCGCCTCAGCCTTCCTTCCTGAGTGTGCGATGGTAAAACACACATATACTGTAAAGCGCATCATGTGTATTTTGTCCTTAAGCGCCCCGCTGACTAGTTGAAGCAGGCCCGGTTTCATCACGCCACAGTGCGGGTGGGCCCGCCGGTGTCACGCAGCCCGTGTGTGTCCCAGCGGCTCGTGACTGAGCTCCCCTGCGTCCTGTAGCCAGGTGCCCGTCACCTGTGTTTCCCGGTCACGCACAGCACACCGTTCCTGCTGCTGGCCGTAGGGGCGCGCCCGGGGAGGAAGGCTGTGCCCGGCGGGACCTGCACTGTGGGGCGCTCCCATCCGCCCCCTCGGGAGAATGCGCACTCTGCTCCTCGCCCCGGAGTTGCCACTGCAGAGACGCAGCCGGGGACCCGAATGGTCTCAGGAGACCAGGCTGTTTTCCCTGGCTTCGCTGATGGTGTGAGCGCGCCCGTGGCCGCAGTGGAGGGCTTGCCGTGGAAGTGAGCCTCATTAAGACGTTCGCGAGATGCGTCACGCTGTCACACGGCCCTTCAGGAGAGGGGAGCCCTGCACAGGGATGCGTCATCCTGGGACAGAAGCCGTGAAGATGACGAGCAACTTTGTCCAGCTGCCCTGCAGCTCCCGGTTGCTCACGTTTGACCCTCGGTTCAAGCTCTGCCTTTTGGAGAAATGCGGAACGAGCCCCTCCTTTTCCCGTGTGACGCCCTCTGAGTGTTTGAAGCTGTTTATTGTGTCTTCAGGTTAAAACATCCCTGCATTCATTCATTCTGCATTTGTTCAATAAATATTTAATTGAATTCTT