Transcript asmbl_19022

Sequence
Transcript Sequence for observation asmbl_19022 of TGE0004100:
CCCGGAGCGCTGAATCCGCGCTTCGGCCCCGGAGCCGCGGTCTCCCGCCATGGGTCTCTGTCTCTTCCTCTACCGCGCACCCCTGCTTCTGTGGGGCCTACTGTTTCTCCTGCTGCTTGCAGTCTCGGCTCTCCAGGCTGGACGTCCGTCCCCTGTGGTCCTGGTGCCTGGTGATTTGGGCAACCAGCTGGAGGCAAAGCTGGACAAGCCAAAGGTCGTGCACTACCTCTGCTCCAAGAAAACAGACAGCTACTTCACACTCTGGCTGAACCTTGAACTGCTGCTGCCTGTCATCATTGACTGCTGGATCGACAATATCAGGCTGGTGTACAATAGAACGTCCCGGACCACCCAGTTTCCTGATGGTGTGGATATGCATGTCCCTGGCTTTGGGAAGACCTTTGCACTGGAGTTTCTGGACCCCAGCAAAAGCAGTGTGGGTTCCTATTTCCACACTATGGTGGAGAGCCTTGTGGGCTGGGGCTACACACGGGGTAAGGATGTCCGGGGGGCCCCCTATGACTGGCGCCGAGCCCCAAATGAAAACGGGCCCTACTTCCTGGCCCTCCGGGAGATGATCGAGGAGATGCATCAGCTGTATGGGGGCCCCGTGGTGCTGGTTGCCCACAGTATGGGCAACATGTACACGCTCTACTTTCTGCAGCGGCAGCCACAGGCCTGGAAGGACAAGTACATCCGTGCCTTCTTGGCACTGGGTGCGCCTTGGGGGGGCGTGGCCAAGACCCTACGCGTTCTGGCCTCAGGAGACAACAATCGGATCCCGGTCATTAGTCCCCTGAAGATCCGGGAGCAGCAGCGATCTGCTGTCTCTACCAGCTGGCTCCTGCCCTATAACTATACCTGGTCACCTGAGAAGGTCTTCGTGCGCACACCCACGGCCAACTACACGCTGCGCGACTATCACCGGTTCTTCCAGGACATTGGCTTTGAAGATGGCTGGCTCATGCGGCAGGACACGGAAGGGCTGGTAGATGTCACAATGCCACCTGGCGTACAGCTGCACTGCCTCTATGGCACTGATGTCCCCACGCCGGACTCCTTCTACTATGAGAGCTTCCCGGACCGCGACCCTAAAATCTACTTTGGCGATGGTGATGGCACTGTGAACTTGCAGAGTGCCCTGCATTGCCAGACCTGGCGCAACCACCAGGCACACCAAGTATCATTGCAGGCGCTGCCAGGCAGTGAGCATATTGAAATGCTGGCCAATGCCACCACTCTGGCCTATCTGAAACGCATGCTCTTTGGGCCCTGATTCCTGTCCCAGCCAGGGCTGCGCGATGGCTCGGCTACAGCTGCTTCTCTTGGACTCTGGGGCTGCGATGGCCCATGAGTTTAGCAGTTTGTGACTGACCATCCAAGGTCCTGAGTCTTTGGTTGTGAAACATCTTCCATATGAAGTGCTGTTTCTTATCCTTTCTCTGGGAGGGAGGAAGGAAGAAATAGTCTAGACTCACTTGAGGGACCCTTAATGGAAAGAATGCTGCTGCTGATGGAATTGTGACCTCAGGACTGGCTCTGCAGGTGGATTGGCTGGCACCTGGATCCAATCCCCAACTCAGGGGCCATGTGTTCCTCCTATGCCTGTGGCCTTTTCACATTTACCCACCAGGCCTGGCCCCTCAGCCTTCCTGTAAGTGATATGACTAAGCTGTGGTTCCTACCCCCACAGGCCCCAGGAATGGGCTCCTGGTCCCTAGGGTGACCCTTCCCACACACTGGCCACAGGTGAGCCTACTACTGGCCATGGGTGGCTGGAGCTGCTGGCTTCCTTGTAGCATAGCTGCTTGACAGTCTGACTGGCTTTCTGAGGGCAGTCCAGTTTCCCCTGCAGGCAGGGGCAGATTGTTGTGTTCTCTGTGGTTCTCAGGCTCTGGGGCATTCACTCTTACCTCCCTCACCTCTAAAAACAGCCTAGCTCAGGATTGGGCAGCAGATGGCCCCTTAGTTCTGCAGCCATGGCCCAGGAGCTCTGATCCCCTTGGTCGGGCTGTTTCCCACAGTACTGATGTTAGCTTCCTTTACCTTGGGACTATGGTTCAAGGATAAGAGCAGGGCCCAGTGCCATGGCCTTTTAGGTCCTCATGAAGAAAGAAAACTTAAGGACACAGACAAGATGATTCGGAGTTTCTCTGAACTGCCCTCTTGCTAACTCTACCACCATACTGCCACCCTTCCCCACGGTTTCTCTAGTACCCAAGTGGGCTGGCACAGAGTCGAAAGGAGACAGGGCTTCTGCCCATCCTGCCCAGCACATACCTCCACCAGGCAGCTCAGTGGTGTTTAGTCTGCAGGGACAGCTCAGAACATACTTTGGGACCCTGTGAGACCCAGGTGCCTTGGAGCCCCCTTGGGGGTTTCTGTCTGCCTCAGAGGTGCTGCATGAGTCTCCTTGTGATAGCAGGGCTGGAGAATCTGGATTTACCTTGGTGGCAGTGGTCTCCAAGTAGGCGACAGCTATAAGCCAAGACTTGGGTCTAGCCTCTAGGGTGAGGCCCCAAAGCCACAGTCAGACTAGACTGTGCTGTTCTCCCACAAGATTTCTGTGGAGCCGGATTTTCTCTGTTGTGTACATACCCAGCATCTGTCTCTCCCTTTGTTTCTGAGTGGTGGGCCTCACCTGCATGGGGCTCTGAGCAGGCTGTACCTCGATTCTGGCAATAAAAGTATTCTGGATACTGTAAA