Transcript asmbl_19010

Sequence
Transcript Sequence for observation asmbl_19010 of TGE0004098:
AGTTGGAGGGGCTCAGGGACGCGGTGCGGGCCGCGGTTTGTGGGCTGCGGGTGGTGACCAGCATCCTGCTGTCTGGCCCCGGTGCGGCTGTACTCGGCTGGATAGTGCGCAGCGGCAGCGACACGAACCCGGCGCGGACAGGGCGCCCGTGGCTGGGCCCATGGCCTCCTGCGCGAGCATCGACATCGAGGACGCCACGCAGCACCTACGGGACATCCTCAAGCTGGACCGGCCCACGGGGGGCCCCAGTTCAGAGAGCCAACGGCCATCTAACGCCTACAATGGGGACCTCAATGGACTCCTGGTCCCAGACCCCCTCTGCTCAGGTGATGGTACTTCAGCAAACAAGCCTGGTCTCCGGGCCATGCCACCTATTAACCTGCAGGAGAAGCAGGTCATCTGCCTTTCAGGAGATGACAGCTCTACCTGCATTGGGATTTTGGCCAAGGAGGTGGAGATTGTGGCCAGCAGTGACTCTAGCATCTCGAGCAAGGCACGAGGGAGCAACAAGGTGAAAATCCAGCCTGTTGCCAAGTATGACTGGGAGCAGAAATACTACTACGGCAACCTGATTGCTGTGTCCAACTCCTTCTTGGCCTATGCCATTCGGGCTGCCAACAATGGCTCAGCGATGGTGCGGGTGATCAGCGTCAGCACTTCGGAACGGACCTTACTCAAGGGCTTCACAGGCAGTGTGGCTGACCTGACCTTTGCACACCTCAACTCTTCACAGCTGGCCTGCCTGGATGAGGCAGGCAACCTGTTTGTGTGGCGCTTGGCTCTGGTTAATGGCAAAATTCAAGAAGAGATTTTGGTTCATATCCGGCAGCCAGAGGGTACACCACTGAACCACTTTCGTAGAATCATCTGGTGCCCCTTCATCCCTGAGGAGAGTGAGGATTGCTGTGAGGAGGGCAGCCCAACGGTGGCCCTGTTGCATGAAGACCGGGCTGAGGTGTGGGACCTAGACATGCTCCGCTCCAACCACAGCACCTGGCCTGTGGATGTCAGCCAAATCAAGCAGGGCTTCATTGTGGTGAAAGGCCATAGCACATACCTGAGTGAAGGGGCCCTCTCACCTGATGGGACTGTCCTGGCCACTGCAAGCCATGATGGCTTCATCAAATTCTGGCAGATCTACATTGAGGGGCAGGATGAGCCAAGGTGTCTGCACGAGTGGAAGCCTCATGATGGGCGGCCCCTTTCCTGCCTCCTATTCTGTGACAACCACAAGAAACAGGACCCTGATGTCCCTTTCTGGAGGTTCCTCATTACTGGCGCTGACCAGAATCGGGAGCTGAAGATGTGGTGCACAGTGTCCTGGACCTGCCTGCAGACTATTCGCTTCTCCCCAGATATCTTCAGCTCAGTGAGTGTTCCCCCTAGCCTCAAAGTTTGCCTGGACCTCTCAGCAGAATACCTGATTCTCAGTGATGTGCAACGGAAGGTCCTCTACGTGATGGAGCTGCTGCAGAACCAGGAGGAGGGCCGTGCCTGCTTCAGCTCCATCTCTGAGTTCCTGCTTACCCACCCTGTCCTGAGCTTTGGTATCCAGGTCGTGAGTCGCTGCCGACTGCGGCACACTGAGGTGCTGCCTGCCGAGGAAGAGAACGACAGCCTAGGGGCTGATGGGACCCACGGAGCTGGTGCCATGGAGTCTGCAGCTGGTGTGCTCATCAAGCTCTTCTGTGTGCATACTAAGGCTTTGCAAGATGTGCAGATCCGCTTTCAGCCACAGCTAAACCCTGATGTGGTGGCCCCGCTCCCTACCCACACTGCCCATGAGGACTTTGCATTTGGAGATTCTCAGCCTGAACTGAGCTCCGGGGGGCTGGGATCAGCTGCTCATGGCTCCCAGCCTGACCTCCGACGCATTGTGGAGCTGCCTGCACCTGCTGACTTCCTTAGTCTGAGCACTGAGACCAAGCCCAAGCTGATGACACCTGATGCTTTCATGACATCTAGCACCTCCCTGCAGCAGATCTCTGCATCCCCTAGTAATAGCAGCGGCGGCAGCAGCAGTGGTAGCAGCAGCAGCAGCAGCAGCTCCTCTCTTACAGCTGTGTCTGCCATGAGCAGTACCTCGGCTGTGGACACCTCCTTGTCCAGGCCCCCTGAGGAGCTGACCTTGAGCCCCAAGCTGCAGCTGGATGGCAGTTTGACAATGAGCAGCAGTAGCAGCCTGCAGGCAAGCCCACGCAGCCTCCTGCCCGGCCTGTTACCAGGTCCAGCTGACAAATTGACTCCCAAAGGGCCTGGGCAGGTGCCTACTGCTGCCTCTGGACTGTCCCTGGAGCTGCAGGAAGTGGAGCCCCTGGGGCTACCCCAGGCTTCCCCTAGCCGTACTCGCTCCCCTGATGTTATTTCCTCAGCTTCCACTGCCCTGTCCCAGGATATCCCTGAGATCGCGTCTGAGGCCCTGTCCCGTGGCTTTGGCTCCTCTGCTCCTGAGGGCCTTGAACCGGACAGTATGGCCTCAGCTGCTTCAGCACTACACTTGCTGTCCCCACGGCCACGGCCCGAGCTTGGGCCCCAGCTTAGCCTGGATGGAGGCCCTGGGGATGGGGATCGGCATAGTACCCCTTCCCTCCTGGAGGCAGCCTTGACCCAAGAGGCTACAGCCTCTGACAGTCAGGTCTGGCCAACAGCACCAGACATTACTCGGGAGACCTGCAGCAGCCTGGCAGAAAGCCCTAGGAATGGCCTTCAGGAAAAGCACAAGAGCTTGGCCTTCCACCGACCGCCTTATCATCTGCTGCAGCAACATGACAGCCAGGATGCCAGTGCTGAACAAAGTGACCATGATGATGAGGTGGCCAGCATTGCCTCTGCTGCAGCGGGCTTTGGCACCAAAGTTTCCACTCCACGGCTTCCTGCCAAGGACTGGAAGACCAAGGGATCTCCTCGGGCCTCACCTAAGCTCAAGAGGAAGGGCAAAAAGGATGATGGGTAGGAGGGGTCCTGGGGCCAGGGAGAGGGGTGGTCCCCAGGCTGTCTAGGCCTGAGGTGCTTCTCGCCTGTGGCAGGGATTCGACTGCGGGATCCCGGCTCATGGAGCACCAGGTGACAGAGCCCCCTGAGGATTGGCCTGCAATAATTTGGCAACAGCAGAGAGAGCTGGCAGAGCTGCGGCACAGCCAAAAAGAGCTACTGCAGCGTCTGTGCACCCAGCTCGAAGGCCTGCAGAGTACCGTCACAGGCCATGTAGAACGTGCCCTCGAGTCCCGGCATGAACAGGAGCAGCGGCGGTTGGAGCGGGCACTGGCAGAAGGGCAGCAGCGGGGTGGGCAGCTACAAGAGCAGCTGACGCAACAGCTGTCACAGGCACTGTCTTCAGCTGTGGCTGGGAGGCTGGAACGCAGCATACGGGATGAGATCAAGAAGACAGTGCCTCCATGTGTCTCTAGGAGTCTGGAACCCGTGGCAGGCCAACTGAGCAACTCAGTGGCCACCAAACTCACAGCTGTGGAGGGTAGCATGAAAGAGAATATCTCCAAGCTGCTGAAGTCCAAGAACTTAACAGACGCTATTGCCCGAGCAGCTGCAGACACGTTACAAGGGCCAATGCAGGCTGCCTACCGTGAAGCCTTCCAGAGTGTGGTGCTGCCTGCCTTCGAGAAGAGCTGCCAGGCCATGTTCCAACAGATCAATGATAGCTTCCGACTGGGCACACAGGAATACTTGCAGCAGCTAGAGAGCCACATGAAGAGCCGGAAGGCACGAGAACAGGAGGCGCGGGAGCCTGTGTTGGCCCAGCTGCGGAGCCTGGTCAGCACACTGCAGGGTGCCACTGAGCAGATGGCAGCCACTGTGTCTAACAGTGTTCGGGCTGAGGTGCAACACCAGCTGCATGTGGCTGTGGGCAGCCTGCAGGAGTCAATTTTAGCACAGGTACAGCGCATTGTTAAGGGTGAGGTGAGTGTGGCACTCAAGGAGCAGCAGGCCTCCGTCACCTCTAGCATCATGCAAGCCATGCGCTCAGCTGCAGGCACACCTGTCCCAGCTGCCCACCTCGACTGCCAGGCCCAGCAAGCCCATATCCTGCAGCTGCTGCAGCAGGGCCACCTCAATCAGGCCTTCCAGCAGGCCCTCACGGCTGCTGACCTGAACCTGGTGCTGTATGTGTGTGAAACTGTGGACCCAGGCCAGGTTTTTGGGCAGCCACCCTGCCCACTCTCCCAGCCCGTGCTCCTTTCCTTCATCCAGCAGCTGGCCTCTGACCTTGGCACTCGAACTGACCTCAAGCTCAGCTACCTGGAAGAGGCTGTGATGCACCTGGACCACAGTGACCCCATCACTCGGGACCACATGGGTTCCGTCATGGCCCAGGTGCGCCAGAAGTTATTCCAGTTCCTGCAGGCTGAGCCATACAACTCACTTGGCAAAGCGGCCCGGCGTCTTAGCCTCATGTTGCATGGCCTTGTGACCCCCACCCTCCCTTAGCAAAGCCTGCCTTGCCCAGGGGTGCAGTGGCATTGAAGACCAGCAGACAGGCCTAGACCAAAGCAGGGTCATGTCTGCCCTTTATCTGCTCAGGCTCCCACCTCTGGGGTAGTTGAGAGGGGGAACACTGGCTGTAGTCTACAGGTTATGGTAGCCAGCAGGTTTAGGCTGAGCCCAGGGTGGGTATTGTGCCTTCTTGGGTTCTGCCATGCCTGGAGCATGACCCCCTGAGATTGTGATACCACTTGAGTTGAATTTTCCATGTTCCTTTTTACCTCTGTTTTGGATCTTTCTGTTTTTGAAAAACATTGAGAAATTCAATTAAATGCTTTTGGAATAAAATGGAGTATGCGTTTGTT