Transcript asmbl_18867

Sequence
Transcript Sequence for observation asmbl_18867 of TGE0018207:
AGCCGGCGCCGAGTCAGCTGGTTTTGGAATTGCGCTGCGTGCCTGCGGGTTGGGGTTCTCTGGTCCCGCCGGCCCCGCCGCAGCCATGTCGTTCTTCCCGGAGCTTTACTTCAACGTGGACAATGGCTACTTGGAGGGACTGGTGCGCGGCCTAAAGGCTGGTGTGCTCAGCCAAGCCGACTACCTCAATTTGGTGCAGTGCGAGACGCTCGAGGACCTGAAGCTGCACCTGCAGAGCACTGACTACGGTAACTTCCTTGCCAATGAGGCATCACCACTGACAGTGTCAGTCATCGATGACCGGCTCAAGGAGAAGATGGTGGTAGAGTTCCGCCACATGAGGAACCATGCCTACGAGCCACTCGCCAGCTTCCTGGACTTTATTACTTACAGCTACATGATTGACAACGTGATCCTACTCATCACGGGCACGCTGCACCAGCGCTCTATCGCCGAGCTTGTGCCCAAGTGCCACCCACTAGGCAGCTTTGAGCAGATGGAGGCCGTGAACATTGCGCAGACACCTGCTGAGCTCTACAATGCTATTCTGGTGGACACACCCCTGGCGGCTTTTTTCCAGGACTGCATCTCAGAGCAGGACCTCGATGAGATGAACATTGAGATCATCCGCAATACGCTCTACAAGGCCTACCTGGAATCCTTCTACAAGTTCTGCACCCTACTGGGCGGGACCACAGCTGATGCCATGTGCCCCATCCTGGAGTTTGAAGCAGACCGCCGCGCCTTCATCATCACCATCAACTCCTTTGGCACAGAACTGTCTAAAGAGGATCGTGCAAAGCTCTTTCCACACTGTGGGCGGCTCTACCCAGAGGGCCTGGCCCAGCTGGCTCGGGCTGATGACTACGAACAAGTCAAGAACGTGGCTGACTACTACCCGGAGTATAAGCTGCTCTTTGAAGGAGCAGGGAGCAACCCCGGAGACAAGACCCTGGAGGACCGATTCTTTGAGCATGAGGTAGGTGCCAGGCCTGCCCGTCACAGGGAGGGGTTGGTGGCTCAGGCTTCACTCTGCGGTCACGGCCACATGCACACTGTACCTACCTCTGTCCACAGGTGAAACTGAACAAGTTGGCCTTCCTGAACCAGTTTCACTTTGGTGTCTTTTACGCCTTTGTGAAGCTCAAGGAGCAGGAGTGTCGCAACATTGTATGGATTGCCGAGTGCATTGCCCAGCGTCACCGCGCCAAGATCGACAACTATATCCCCATCTTCTAGTGCCCTGGCCCAAGGCTCCCCATAAGTGTGTGTGTGTCTGTGCTGTGACCGAGGCTCCAGCTCACCTGCCTGTTCTGGGGGTAGCACATTGTCTTAGTGGCTGCCCAGTTTCCCTGACACTCTGCTCTTGGGCCTGAAAAGAGGCTGAGTACCTGTTCTCCCCACCAAGGATGGATGGACCAAGGCCCCACCTCCAGATCAAGGAGGCCCCTCAGTCCTGTTTACAGCCACTGACATGTCTGAGAAGCATGTGGTCACTTTTGTGTCCTTCCCTAACCTGAGAATCACTGGGGGCAACATGAGCCTCCTCTCTCCTTTATGGGTCAACCCCAGAGACATGGCCCAGGGGAAGGATAGTGTGTGTCTTTGAGGCATGGGGGTGCATCCCCCTCCTTCAGCTCTGCCCTTCAACAATAAACTGCCCTCTCCAAACCTG