Transcript asmbl_1810

Sequence
Transcript Sequence for observation asmbl_1810 of TGE0018185:
TCAACGAGGCGGCCGAGCAGGTCGGGGCCGGCGTTCGTGCGGGTTCGCGCTGGGCCGGGATCGGGCAGGAAGCTGCGAGGGCCACGGGGGCTCGAGCAGCGCAGGGGGCTGCCCCGAATCCATCCGTGCGGGCCAGGTTCCGCGAGTCGGCTGAATAGGGAGCATTGGGCCGGTGTTCCGAGTCCCGGCTGAACCCCGGGAGGTGAACCGGCTTTTAGGAGAGTGGCTTGCCCGCGCCACCTGCCTGAGCTATCCGACGAGGCCTTGGTCTCCCCAGCAAACGCAGAGATGCAGATCTTTGTGAAGACCCTGACAGGCAAGACCATCACACTTGAGGTCGAGCCCAGTGACACCATTGAAAACGTCAAAGCTAAAATCCAAGACAAGGAGGGCATCCCACCTGACCAGCAGCGTCTGATTTTTGCGGGCAAACAGCTGGAGGATGGCCGCACTCTCTCAGACTATAATATCCAGAAAG