Transcript asmbl_13951

Sequence
Transcript Sequence for observation asmbl_13951 of TGE0000231:
GCTCCAGCTGGCGGGAAGGAGGAAGGGCCGGGCGCGGCGCAGAGGCGGGCGCCTACCAGCCGGCAGCTCCGGAGCTGCCCGCGCCATGTCCGCGCACAATCGGGGCACCGAGCTCGACCTTAGCTGGATCTCCAAAATACAAGTGAATCACCCGGCAGTTCTGAGGCGTGCGGAACAAATCCAGGCTCGCAGAACCGTGAAAAAGGAGTGGCAGGCTGCTTGGCTCCTGAAAGCTGTTACCTTTATAGATCTTACTACACTTTCAGGTGATGATACATCTTCCAACATTCAAAGGCTCTGTTATAAAGCCAAATACCCAATCCGGGAAGATCTCTTAAAAGCTTTAAATATGCATGATAAAGGCATTACTACAGCCGCCGTTTGTGTTTATCCCGCCCGGGTGTGTGATGCTGTAAAAGCACTCAAGGCTGCAGGCTGTAATATCCCTGTGGCATCAGTGGCCGCTGGATTTCCAGCTGGACAGACTCATTTGAAGACACGATTAGAAGAGATCAGATTGGCTGTGGAAGATGGAGCTACAGAAATCGACGTGGTAATTAACAGAAGCTTGGTGCTGACAGGCCAGTGGGAAGCCCTGTATGATGAGATTCGTCAGTTTCGCAAGGCCTGTGGGGAGGCTCATCTTAAAACTATATTAGCGACAGGAGAACTTGGAACTCTTACTAATGTCTATAAAGCCAGTATGATAGCAATGATGGCAGGATCAGATTTTATTAAGACCTCTACTGGAAAAGAAACAGTAAATGCCACCTTCCCGGTAGCTATAGTAATGCTGCGGGCCATTAGAGATTTCTTCTGGAAAACTGGAAACAAGATAGGGTTTAAACCAGCAGGAGGCATCCGCAGTGCAAAGGATTCCCTTGCTTGGCTCTCTCTTGTAAAGGAGGAGCTTGGAGATGAGTGGCTGAAGCCAGAACTCTTTCGAATAGGTGCCAGTACTCTGCTCTCGGACATTGAGAGGCAGATTTACCATCATGTGACTGGAAGATATGCAGCTTATCATGATCTTCCAATGTCTTAAATCAGTCACCAGTTCCAGAAAAGTTCTTTACGACAATGTTTAAAAATTATTTTTCTACGTAATTGCTAAAATTATTTAATTAAAAAATTGGGCAGTAGGTAACTGGCATTCCTCTCTTTAAAATTTCTACCGAACTTAATGGAATGGAAAAAGCAAACTCATCCACATGTGGTACTCATTTCAGGCACATCTGAAATGATCTTAATTACTAGAAGATCTGCACTATTAACTTTGTGAAGAGTTTCTCCTAAAAACTTTAAGTAAAATGTTAATGGTAGCTTTGATAACATCAAATTCTAAGGGAGAAAAAAACAATATTAAACCGCCCAAGCAGTGTGCCCTAGCAGAGGAAAATGCAACATCTCGCAAGCGCTGCTGTAACGACTTCAGGAGTCACTGATTCAGCACTAATTTCCTGCTGTGAAAACTCATCTTTCATTTTTGCCGTGGATAGGCGCTTTTATTAATTGTTGTCCTAATGAAATTTCTGACATTGTCATATACAACGATGA