Transcript asmbl_17815

Sequence
Transcript Sequence for observation asmbl_17815 of TGE0004025:
GCGGCAGCGGCGGCGGCGGCGGCGTGCGGGGCCCCACGGTGTAAACAGCCCCGGAGGCGGCGACCGAGACCCCGAGAGGGAAGCGGCAGCTGAGGCAGGGTCCTCGGTTGGAAGCCTGGGCTGAGTGCAGCTGGGAGCCTCTGCGGCGGCGTGAGCAGACGCCCTAGACCTCGCCTCCCTCCCTTGCCCCAGATTTATTACTAAACATGGGTGCATTTTTGGATAAACCCAAAACTGAGAAACATAATGCTCATGGTGCTGGGAATGGTTTACGTTATGGCCTGAGCAGCATGCAAGGATGGAGAGTAGAAATGGAAGATGCACACACAGCTGTTGTAGGTATTCCTCACGGCTTGGAAGACTGGTCATTTTTTGCAGTTTATGATGGTCATGCTGGATCCCGAGTAGCAAATTACTGCTCAACACATTTACTAGAACACATCACTAATAATGAAGACTTCAGGGCAACTGGAAAATCAGGATCTGCTCTTGAGCCTTCAGTGGAAAATGTCAAGAATGGTATCAGAACTGGCTTTTTGAAAATTGATGAATACATGCGTAACTTTTCAGACCTCATTAGCGGTTCAACTGCAGTGGGAGTTATGATTTCACCTAAGCATATCTACTTCATCAACTGTGGTGATTCACGTGCTGTTCTGTATAGGAATGGACAAGTCTGCTTTTCTACCCAGGATCACAAACCTTGCAATCCAAGGGAGAAGGAGCGAATCCAAAATGCAGGAGGCAGTGTAATGATTCAACGTGTTAATGGTTCATTAGCAGTATCTCGAGCTCTGGGGGACTATGATTACAAGTGTGTTGATGGCAAGGGCCCAACAGAACAACTTGTTTCTCCAGAGCCTGAGGTTTATGAACTTTTAAGAGCAGAAGAGGATGAATTTATCATCTTGGCTTGTGATGGGATCTGGGATGTTATGAGTAATGAGGAGCTCTGTGAATTTGTTAAATCTAGGCTTGAGGTATCTGATGACCTGGAAAATGTGTGCAATTGGGTAGTGGACACTTGTTTACATAAGGGAAGTCGAGATAACATGAGTATTGTACTAGTTTGCTTTTCAAATGCCCCCAAGGTCTCAGAAGAAGCAGTGAGAAAAGATTCAGAGTTGGATAAATACTTGGAATCACGGGTTGAAGAAATTATGGAGAAGTCGGGTGAGGAAGGAATGCCTGATCTTGCCCATGTAATGCGCATCTTGTCTGCAGAAAATATCCCAAATTTGCCTCCTGGGGGAGGTCTTGCTGGCAAGCGCAATGTTATTGAAGCTGTTTATAGTAGACTGAATCCACACAGAGAAAGTGATGGGGGTGCTGGAGATCTAGAAGACCCATGGTAGCCTTATAAACCTTCTAAAATGCTTTTGATTCTGAAAATTGGGGGAAAAAACTTTTAATCACAATTTTCTTCAATACAAGGGAAAAATATTCTTGTGGATTTCCAACGTTTTGTGATATGAGCAGAAAATAATTAGCATTTCCCATCATTTGTTCATATTTGTGTTTTCTGATAATTGCCACTTTGTAGCATTGCCTGTACTACAGTATTTTTGCCAACCTCAGGCATACTGGTTACATCTGTATTGAACTTTTGGCCCTAGAAACCAATGAAGTTATTTCAGCACATATAATAATTGTGCCTGAGGTGCATGGGAATATAGTTAGCTGTACTCCGAAGATACATTATGGGGTTTTTTTGTTGTTGTTTTTTGTTTTTGTTTTTTTTAACAAGACACACAACATATAAGCATGTAAGAGTAAAGAATTATACGAGATGTTCCTTTTTTCAATTCACCAAGTTGGAAGCCTTTTGCAGCTCTGTGGCTTGAAATTTCATTTGAGCATACTGTAGGATATATATTTATTATTAATTGTTATTTAATTTTTTTTTCCAATTTTACCTGTATTACCAAACTGGGTTCTCCAATAATGTCCAAATTGTAATGTTGCCTGCTTCAAGATAAAGTGTATTTGGCAATAATAATAAAACCCTTACAGGTTTTATGCATGTATTTACTACATCCTTCAATTCTCACTAGAAAATCTTTGAAACCAAATGGATTAATTTATGGCTATTTATAATTTGCTTTGACATCTCACTGCTGCAAATTTTTTAAATGATGAAATTTGCCTTTATAATGTAAATTGTGATTTTTGTTTTAAATGTGGGTTTTAATAGTTTTAATTTTTCAGCTTTTAAGACACAAGTTTTGTGTAATTTGGCATAATTTTTAAT