Transcript asmbl_17687

Sequence
Transcript Sequence for observation asmbl_17687 of TGE0018148:
CCCAGCCACCTCGGCTGGCCTCCTGGGGAGGGGCAAAACCAGGACAGCCAAAGAGATTGCGAGCCACACTGTGACCAAGAGAAGCTGGACGGAGGAAACCGCCACAATGATCCCATGATTCACAAAGCACTGACGTAAGCACTCCCTTTCTCAGAGGGAGTCTCGTAGGCCCCATAGAGTGGCACCCCCACTGCAGGCACTCACAGCAGGAGGCTGGCAGGGAAGAAGGGAAGGGAAGGGGGGAAACCAGGCATCCGGGTTGAGGTCTGCAGCAGCACAGTCTGGCCAGGCAGCAGCATAGACCTGCCCATGCAGGAGACAGCGCTGGACCACCAAGTGTTTGAGGCCAGCCTGGGGGCACAGACCCCAGCCCCTCCCCAGAAGCCTCTGCAGGGACGAGGGCCTCCTGCCTACTAGGCGGTCTCTGGGTGCCTACTGGAGCAGGTACTACGAGACTGGCAGCATCCGGCCTGGGGTGATAGGTGGCTCTAAGCCCAAGGTGGCCACCCCCAAGGTGGTGGAGAAGATCGGGGACTACAAGCGCCAGAACCCCACCATGTTTGCCTGGGAGATCCGGGACCGGCTGCTGGCCGAGGGCGTCTGTGACAATGACACTGTGCCTAGTGTCAGCTCCATCAACAGAATCATCCGGACCAAAGTGCAGCAGCCCTTCAACCTCCCCATGGACAGCTGCGTGGCCACCAAGTCCCTGAGCCCAGGACATACGCTGATCCCCAGCTCGGCCGTGACGCCCCCAGAGTCACCACAGTCTGACTCTCTGGGCTCTACCTACTCCATCAATGGGCTGCTGGGGATTGCACAGCCAGGGGACAGCAAGAGGAAGACTGATGACAGTGACCAGGACAGCTGCCGCCTGAGCATCGATTCACAGAGCAGCGGTGGGGCCCGCAAGCATCTGCGCACAGAGGCCTTTGGCCAGCACCACCTTGAGCCACTCGAGTGCCCCTTCGAGCGACAGCACTACCCCGAGGCCTATGCATCTCCCAGCCACTCCAAAGGCGAACAGGGCCTCTACCCACTGCCCCTGCTCAACAGCACCCTGGACGACGGGAAGGCCACCCTGACCCCGTCCAATACACCCTTGGGGCGCAACCTCTCAACTCACCAGACTTACCCTGTGGTGGCAGATCCTCACTCACCCTTCGCCATAAAGCAGGAAAGCCCCGAGGTGTCCAGTTCTAGCTCCACCCCTTCCTCTTTATCTAGCTCCGCCTTTTTGGACCTGCAGCAAGCCGGCTCTGGGGTCGCAGCCGGCACCTCGGTCCCGCCCTTCAATGCCTTTCCCCACGCTGCCTCCATGTACGGGCAGCTCGCGGGCCAGGCCCTCCTCTCAGGTACGACAGGGAGGTCCGGGCCAGCAGCCTAAGG