Transcript asmbl_17398

Sequence
Transcript Sequence for observation asmbl_17398 of TGE0003993:
GTGCGTCTCACCTGCGTAGTTTTTGCCCGGCGGGAACGCGCAGCGGGGGAAGTTTGTCTCGGTGAAGGGAAGCTTAACGCTGAGACCCCGGAGCGGCGGCAGCCATGGCGGATGTGACCGCCCGTAGCCTGCAGTACGAGTACAAGGCGAACTCGAATCTTGTCCTCCAAGCTGACCGCTCTCTCATTGACCGTACCCGCCGGGATGAGCCCACGGGAGAGGTGCTGTCCCTGGTTGGGAAGCTGGAGGGCACCCGGATGGGAGATAAGGCTCAACGGACCAAACCGCAGATGCAGGAGGAAAGAAGAGCCAAGCGAAGGAAGCGTGACGAGGACCGGCACGACATCAACAAGATGAAGGGGTACACGCTGCTCTCAGAGGGTATCGACGAGATGGTGGGCATCATTTACAAGCCCAAAACCAAAGAGACCCGGGAGACCTACGAGGTGCTGCTTAGCTTCATCCAGGCTGCCCTTGGGGACCAGCCACGTGATATTCTGTGTGGGGCAGCTGATGAAGTTCTAGCTGTCCTAAAGAATGAAAAGCTTCGTGATAAAGAAAGGAGAAAGGAGATCGACTTGCTGTTGGGTCAGACAGATGATACCAGATACCATGTTCTAGTGAACTTGGGCAAAAAGATCACAGACTACGGTGGAGACAAGGAAATCCAGAACATGGATGACAACATTGATGAAACATATGGCGTGAATGTACAGTTTGAGTCTGATGAGGAGGAAGGTGACGAAGATGTGTATGGGGAGGTTCGAGAAGAGGCCTCCGATGACGACATGGAAGGGGACGAGGCAGTGGTGCGCTGCACCCTTTCGGCTAATCTTGTTGCATCTGGGGAACTGATGAGTTCCAAGAAGAAGGATTTGCACCCTCGGGACATTGATGCCTTCTGGCTGCAGCGGCAGCTCAGTCGCTTCTATGATGATGCCATCGTGTCGCAGAAGAAGGCAGACGAAGTGTTGGAGATCTTGAAGACAGCGAGCGATGATCGGGAGTGTGAGAACCAGTTGGTGCTGCTGCTCGGCTTCAACACTTTCGATTTTATTAAAGTGCTGCGGCAGCACAGGATGATGATTTTGTACTGTACCTTGCTGGCCAGTGCTCAGAGTGAAGCTGAAAAGGAAAGGATCATGGGAAAGATGGAGGCCGACCCAGAGCTCTCGAAGTTCCTCTACCAGCTCCACGAGACGGAGAAGGAGGATCTGATCCGGGAGGAGCGGTCCCGGAGGGAGCGAGTGCGGCAGTCCCGAATGGACACTGACCTGGAAACCATGGACCTGGACCAGGGTGGGGAGGCACTGGCCCCGCGGCAGGTTCTCGACTTGGAAGACTTGGTCTTTACCCAGGGGAGCCACTTCATGGCTAATAAACGCTGTCAGCTTCCAGATGGATCCTTCCGTCGCCAGCGCAAGGGCTACGAAGAGGTGCATGTACCTGCTCTGAAGCCCAAGCCTTTTGGCTCAGAGGAGCAACTGCTTCCAGTGGAGAAGCTGCCCAAGTATGCCCAGGCTGGCTTTGAGGGCTTCAAAACACTGAACCGGATCCAGAGTAAGCTGTACCGGGCCGCCCTGGAGACAGATGAGAACCTGCTGCTGTGTGCCCCCACTGGCGCCGGCAAGACCAACGTGGCTCTGATGTGCATGCTCCGAGAGATAGGGAAGCACATCAACATGGATGGCACCATCAATGTGGATGACTTCAAGATCATCTACATCGCTCCCATGCGGTCTTTGGTGCAGGAGATGGTGGGCAGCTTTGGAAAGCGCCTGGCTACCTACGGCATCACTGTCGCCGAGCTGACGGGTGACCACCAGCTGTGCAAGGAGGAGATCAGTGCCACTCAGATCATTGTCTGCACCCCCGAGAAGTGGGACATCATCACCCGCAAAGGCGGCGAGCGCACATACACCCAGCTTGTGCGGCTCATCATCCTGGATGAGATCCATCTCCTTCATGATGACAGAGGTCCTGTCTTAGAGGCGTTGGTGGCCAGGGCCATCCGAAACATTGAAATGACCCAAGAGGATGTCAGGCTCATCGGGCTTAGCGCCACCCTCCCCAACTATGAGGACGTGGCTACCTTTCTACGCGTTGACCCTGCCAAGGGCCTTTTCTACTTTGACAACAGCTTCCGCCCAGTGCCTCTGGAACAGACCTACGTGGGTATCACAGAGAAAAAAGCCATCAAGCGTTTCCAGATCATGAATGAGATAGTCTATGAGAAGATCATGGAACATGCTGGAAAAAATCAGGTACTGGTGTTTGTCCATTCCCGGAAGGAGACGGGGAAGACGGCCAGGGCTATCCGGGACATGTGCCTTGAGAAGGACACACTGGGCCTATTTCTCCGAGAGGGCTCTGCCTCCACCGAGGTCCTGCGGACGGAAGCCGAGCAGTGCAAGAACCTGGAGCTGAAGGACCTTCTGCCCTATGGCTTTGCCATTCACCATGCGGGCATGACCAGGGTGGACAGGACACTTGTGGAGGATCTCTTTGCTGACAGGCACATTCAGGTTTTAGTCTCCACAGCAACTCTGGCTTGGGGTGTGAACCTCCCTGCACACACAGTTATCATCAAAGGCACCCAGGTGTACAGTCCGGAGAAGGGGCGCTGGACGGAACTGGGGGCTCTGGATATTCTGCAGATGCTGGGACGTGCTGGAAGACCCCAGTACGACACCAAGGGTGAAGGCATACTCATCACGTCTCACGGGGAGCTCCAGTACTACCTGTCCCTCCTCAACCAGCAGCTTCCTATTGAGAGCCAGATGGTGTCAAAGCTGCCCGACATGCTCAACGCGGAGGTGGTACTGGGCAATGTCCAAAACGCGAAGGATGCGGTGAACTGGTTGGGCTATGCCTACTTGTACATACGCATGCTGCGGTCCCCAACCCTCTACGGCATCTCTCACGACGATCTCAAGGGAGACCCCTTGCTGGACCAGCGCCGACTGGACCTGGTTCACACTGCCGCCTTGATGCTAGATAAGAACAACCTGGTCAAGTATGACAAGAAGACGGGAAACTTCCAGGTGACAGAACTGGGTCGTATAGCCAGCCACTACTACATCACCAATGACACGGTGCAGACCTACAATCAGCTGCTGAAGCCCACCCTGAGTGAGATCGAGCTTTTCAGGGTCTTCTCGCTGTCCTCGGAGTTTAAGAACATCACCGTGAGAGAGGAGGAGAAACTGGAGCTGCAGAAGCTGTTGGAGCGGGTGCCCATCCCTGTGAAGGAGAGCATTGAGGAACCCAGTGCGAAGATCAATGTGCTTCTCCAAGCCTTCATCTCACAGCTGAAATTGGAGGGCTTTGCACTGATGGCTGACATGGTATATGTGACACAGTCAGCGGGCCGGTTGATGCGGGCCATCTTTGAAATTGTTCTGAACCGAGGTTGGGCGCAGCTGACAGACAAGACCCTGAACCTCTGCAAGATGATTGACAAACGCATGTGGCAGTCCATGTGTCCTCTGCGTCAGTTCCGGAAACTCCCTGAGGAGGTAGTGAAGAAGATTGAGAAAAAGAACTTCCCTTTTGAGCGTCTGTACGACCTGAACCACAATGAGATAGGGGAGCTCATCCGCATGCCCAAGATGGGCAAGACAATCCACAAGTACGTCCACCTGTTCCCCAAGTTGGAGCTGTCTGTGCATCTGCAGCCCATCACGCGCTCCACCTTAAAGGTGGAGCTGACCATCACGCCGGACTTCCAGTGGGATGAAAAGGTCCATGGTTCATCAGAGGCCTTTTGGATTCTGGTGGAGGATGTGGACAGCGAAGTGATACTGCACCATGAGTACTTTCTGCTCAAGGCCAAGTACGCCCAGGACGAGCACCTTATCACGTTCTTCGTGCCTGTTTTTGAACCGCTGCCCCCTCAATACTTCATCCGTGTGGTGTCTGACCGCTGGCTCTCTTGCGAGACCCAGCTGCCTGTCTCCTTCCGACACCTGATCCTGCCGGAGAAGTACCCGCCTCCCACCGAGCTGCTGGACCTGCAGCCCTTGCCCGTGTCCGCCCTGAGAAACAGTGCCTTCGAGAGCCTTTACCAAGACAAATTCCCCTTTTTCAATCCCATCCAGACACAAGTGTTCAACACCGTGTACAACAGCGACGACAATGTGTTTGTGGGGGCCCCCACCGGCAGTGGGAAGACCATCTGTGCGGAGTTCGCCATCCTGCGGATGTTGCTGCAGAACTCGGAGGGGCGCTGCGTCTATATCACCCCCATGGAGGCACTGGCCGAGCAGGTGTACATGGACTGGCACGAGAAGTTCCAGGACAGGCTCAGCAAGAAGGTGGTGCTCCTGACGGGCGAGACCAGCACGGACCTGAAGCTGCTGGGCAAGGGCAGCATTGTCATCGGTACCCCCGAGAGGTGGGACATCCTCTCTCGGCGCTGGAAGCAGCGCAAGAACGTCCAGAACATCAGCCTGTTCGTGGTGGACGAGGCCCACCTCATCGGGGGCGAGAACGGGCCTGTCTTGGAAGTGATCTGCTCCCGGATGCGCTACATCTCCTCCCAGATTGAGCGGCCCATTCGTGTTGTGGCGCTTAGCTCCTCGCTCTCAAATGCTAAGGACGTGGCCCACTGGCTAGGCTGCAGTGCCACCTCCACGTTCAACTTCCACCCGAACGTGCGCCCCGTGCCTTTGGAGCTGCACATCCAGGGCTTCAACATCAGTCACACGCAGACTCGCCTATTGTCCATGGCCAAGCCAGTGTACCATGCCATCACCAAGCACTCTCCCAAGAAGCCTGTCATCGTTTTTGTGCCTTCTCGTAAGCAGACCCGCCTTACGGCAATTGACATCCTCACCACGTGTGCGGCGGACATCCAACGACAGAGGTTCTTACACTGCACCGAGAAGGATCTGATCCCGTACCTGGAAAAGCTGAGTGACAGCACGCTCAAGGAGACGCTGTTAAACGGCGTGGGCTACTTGCATGAGGGTCTCAGCCCCCTGGAGCGGCGTCTGGTGGGACAGCTCTTCAGCTCAGGGGCCATCCAGGTAGTTGTTGCTTCTCGGAGTCTCTGCTGGGGCCTGAGTGTGACCGCCCACCTGGTGATCATCATGGACACCCAGTACTACAATGGCAAGATCCACGCGTATGTGGACTACCCCATCTATGATGTGCTTCAGATGGTGGGGCACGCCAACCGCCCTCTGCAGGATGACGAGGGGCGTTGTGTCATCATGTGCCAGGGCTCCAAAAAGGATTTCTTTAAGAAGTTCTTATATGAGCCATTGCCAGTGGAGTCTCACCTGGACCACTGTATGCATGACCACTTCAATGCCGAGATTGTCACCAAGACCATTGAGAACAAGCAGGACGCTGTAGACTACCTTACCTGGACCTTTCTGTACCGCCGCATGACGCAGAACCCCAACTACTACAACTTGCAGGGCATCTCCCATCGTCACCTGTCTGACCACTTGTCAGAGCTGGTGGAGCAGACGCTGAGTGACCTGGAGCAGTCCAAGTGCATCAGCATAGAGGACGAGATGGACGTGGCTCCTCTAAACCTGGGCATGATCGCCGCCTACTACTACATCAACTACACCACTATCGAGCTCTTCAGCATGTCCCTGAATGCCAAGACCAAGGTGCGTGGGCTAATCGAGATCATCTCCAACGCAGCCGAGTACGAAAACATCCCGATCCGGCACCACGAGGACAACCTGCTGCGGCAGTTGGCTCAGAAGGTCCCCCACAAGCTGAACAACCCCAAGTTCAATGACCCACATGTCAAGACCAATCTACTTCTTCAGGCTCATCTGTCTCGTATGCAGCTGAGCGCTGAGCTGCAGTCAGATACAGAGGAGATCCTTAGCAAGGCCATCCGGCTCATCCAGGCCTGTGTGGATGTCCTCTCCAGCAATGGGTGGCTCAGCCCTGCTCTGGCAGCCATGGAGCTGGCCCAGATGGTCACCCAAGCCATGTGGTCTAAGGACTCATACCTGAAACAGCTGCCTCATTTCACTTCGGAGCACATCAAACGTTGCACAGACAAGGGAGTGGAGAGTGTTTTCGACATCATGGAGATGGAGGATGAAGAACGGAACGCATTGCTTCAGCTGTCTGACAGCCAGATGGCAGACGTGGCCCGTTTCTGTAACCGCTACCCTAACATTGAGCTGTCTTACGAAGTTGTGGATAAGGACGGCATCCGCAGTGGCGGGCCCGTTGTGGTGCTGGTGCAGTTGGAGCGAGAGGAGGAAGTCACAGGCCCCGTGATTGCGCCTCTCTTCCCACAGAAACGTGAGGAGGGCTGGTGGGTGGTGATTGGAGACGCCAAGTCCAACAGCCTTATCTCCATCAAGAGGCTGACCCTGCAGCAGAAGGCCAAGGTGAAGCTTGACTTTGTGGCCCCAGCCACTGGCGCCCACAACTACACTCTATATTTCATGAGCGATGCTTACATGGGATGTGACCAAGAATACAAGTTCAGTGTAGATGTGAAAGAAGCCGAGACAGACAGCGACTCGGATTGAGTGTGGAGGCCTGTGCTCTTGCCTGGAGGGGTTGGACCTGAACAAAGAGCATGTCTGGGTCACAGTTGTGGACAGTAAGTCTGCTGGCATGAGGGCGGACTGCCAGGCAGTGCAGGTGCACCCCAGGGCCCCTCCACATTTCCTCTTGCCACCTTGGCATCCAAGCTTTGGATCCGGTGTCTGTAGGTGTCGTGTAGCTGTCGTGTTAACTGGATAGCATTTTTAGGCATGTTCTTTGTTTTATTAGGTGTTTTAATAAAATCAGTTGGAGAAATCA