Transcript asmbl_16486

Sequence
Transcript Sequence for observation asmbl_16486 of TGE0001731:
AGTGCCTTTCATCTGAGAAGTTCAAGGCACTTCGTAGAACTTCTGCCACACAGGCCGTGGGTCTTGCAGCACATTTGTAAGCAATGGCTGCCATCAGGAAGAAATTGGTGATTGTTGGTGATGGAGCCTGTGGCAAGACCTGCTTGCTTATCGTTTTTAGCAAGGACCAGTTTCCAGAGGTGTATGTACCCACAGTGTTTGAGAACTATGTGGCAGATATTGAAGTGGATGGAAAGCAGGTAGAGTTGGCTTTGTGGGACACAGCTGGGCAGGAAGATTATGATCGCTTGAGGCCCCTCTCCTACCCGGACACTGATGTTATACTGATGTGTTTCTCCATTGACAGCCCTGATAGTTTAGAAAACATCCCAGAAAAATGGACTCCGGAAGTCAAGCATTTCTGTCCCAATGTGCCCATCATCCTGGTTGGAAACAAGAAGGACCTTCGGAATGATGAGCACACAAGGCGGGAGCTAGCCAAGATGAAGCAGGAGCCGGTAAAACCAGAAGAAGGCAGAGATATGGCGAACAGGATTGGCGCTTTTGGGTACATGGAGTGTTCAGCAAAAACCAAAGATGGAGTGAGGGAGGTTTTTGAAATGGCCACGAGAGCTGCTCTGCAAGCCAGACGTGGGAAGAAAAAATCTGGGTGCCTTGTCTTGTGAAACCCTGCTGCAAGCACAGCCCTCATGCGGTTAATTTTGAAGTGCTGTTTATTAATCTTAGTGTATGATTACTGGCCTTTTTCATTTATCTATAATTTACCTAAGATTACAAATCAGAAGTCATCCTGCTACCAGTATTTAGAAGCCAAGCCAACCATGATTATTAATGATGTCCAGCCCACCTGACCCGCCGGGGGCCTTCTGACACCGCTCTAACAGCCCTCCTCTGCACTCCACCTGACACACCAGGCACTAATTCAAGGGATTTCTTAACTTCTTGCTTCTTTCTAGAAAGAGAAATGGTAACTTTTGTGAATTAGGCTGTAACTACTTCATAACTAACATGTCTTGCCTCTCATCTGTCAGCTGCAACGTATTCTGGTGAGTCACCACTTCAGAGCTTTACTCCTTAACAGATTGCATTGGCATAGCTCTGGAGTGGCCATCCAGTTTTTTCAAAATGGGCTCAGCCAGAAAGGCCCAAGTCCATGCAGCTGTGGCAAAGTTACAGTTCTGTGGTTTCATGTTAGTTACCTTATAGTTACTGTGTAATTAGTGCCACTTAATGTATGTTACCAAAAATAAATATATCTACCCCAGACTAGATGTAGTATTTTTTGTATAATTGGATTTCCTAATACTGATATTTGTCATCCCCACAGAAAGTGTATTGGTTTTTTAAAAAAGAAAGTGTATTTGAAAATAAAGTCAGATGGAAAATTCATTTTTTAAATTCCCGTTTTGTCAGTTTCTCTGATAAAAGATGACCATCTCACCTGTTTTCAGCCCCACATGTCCCAGTCCCCCTCCCCAGAGCTGGGCTAAGTAAGTAGGAATTTGGTTTCAAGCGCCCGAGGCACTCAGACACTTCTGAAGGTGGCACAACCTGTCTGGACCGCAGGGTCGGCCTCTAGTTCACAGTGCTTTCTCCTCACTGTATCTAGGTTCCCTCCCAGAGGAGCCACCAGTTCTCGTGGGTGGCACTGTGTTTCTCTCCTCTCCAGCTGACTAAACTTTTTTTCTGTACCAGTTAATTTTTCCAACTACTAATAGAATAAAGGCAGTTTTCTAAA