Transcript asmbl_16140

Sequence
Transcript Sequence for observation asmbl_16140 of TGE0001765:
CCCGCGTGTGGCGCAGGCCAGGACCCTGAAAATAAACAGCCGCTACTTTGCGAGCGTCTCTCCCTGGGTCTGCGTCATTTTCTCTGCCGCTTCGGGCCCGTTCAGACACCGAAGAATAATTATCAAAAAATACACTAAAAGCTAGAAGTAATTTCAAGTGGTTAAATGTTGTTTTTAATACTTTGAAGATCTGACTGTAGCCATGAGCAGCAATGAGTGCTTCAAGTGTGGACGATCTGGCCACTGGGCCCGGGAATGCCCGACTGGTGGAGGCCGTGGTCGTGGAATGAGAAGCCGTGGCAGAGGTGGTTTTACCTCAGATAGAGGTTTCCAGTTTGTTTCTTCATCTCTTCCAGACATCTGTTATCGCTGTGGTGAGTCTGGTCATCTTGCCAAGGATTGTGATCTTCAGGAGGATGCCTGCTATAACTGCGGTAGAGGTGGCCACATTGCCAAGGACTGCAAGGAGCCCAAGAGAGAGCGAGAGCAATGCTGTTACAACTGTGGCAAACCAGGCCATCTGGCTCGTGACTGTGATCATGCGGATGAGCAGAAGTGCTATTCTTGTGGAGAATTTGGACACATTCAAAAAGACTGCACCAAGGTGAAGTGCTATAGGTGTGGTGAAACTGGTCATGTAGCCATCAACTGCAGCAAGACAAGTGAAGTCAACTGTTACCGCTGTGGCGAGTCAGGGCACCTTGCCCGGGAATGCACGATTGAGGCCACAGCTTAATTATTTTCCTTTGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTATTTTCTCTGAATCCTCTTCACTGGCCAAAGGTTGGCAGA