Transcript asmbl_16137

Sequence
Transcript Sequence for observation asmbl_16137 of TGE0001765:
CCCGCGTGTGGCGCAGGCCAGGACCCTGAAAATAAACAGCCGCTACTTTGCGAGCGTCTCTCCCTGGGTCTGCGTCATTTTCTCTGCCGCTTCGGGCCCGTTCAGACACCGAAGATCTGACTGTAGCCATGAGCAGCAATGAGTGCTTCAAGTGTGGACGATCTGGCCACTGGGCCCGGGAATGCCCGACTGGTGGAGGCCGTGGTCGTGGAATGAGAAGCCGTGGCAGAGGTGGTTTTACCTCAGATAGAGGTTTCCAGTTTGTTTCTTCATCTCTTCCAGACATCTGTTATCGCTGTGGTGAGTCTGGTCATCTTGCCAAGGATTGTGATCTTCAGGAGGATGCCTGCTATAACTGCGGTAGAGGTGGCCACATTGCCAAGGACTGCAAGGAGCCCAAGAGAGAGCGAGAGCAATGCTGTTACAACTGTGGCAAACCAGGCCATCTGGCTCGTGACTGTGATCATGCGGATGAGCAGAAGTGCTATTCTTGTGGAGAATTTGGACACATTCAAAAAGACTGCACCAAGGTGAAGTGCTATAGGTGTGGTGAAACTGGTCATGTAGCCATCAACTGCAGCAAGACAAGTGAAGTCAACTGTTACCGCTGTGGCGAGTCAGGGCACCTTGCCCGGGAATGCACGATTGAGGCCACAGCTTAATTATTTTCCTTTGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTATTTTCTCTGAATCCTCTTCACTGGCCAAAGGTTGGCAGACAGAGGCTACTCCCAGGCCAGTGAGCTTTACTTGCTGTGTAAAAGAAGGAAAGGGGTGGAAAAAAAATCGACTTTCTGCATTTAACTACAAAAAAAAGTTTATGTTTAGTTTGGTAGAGGTGTTATGTATAATGCTTTGTTAAAGAACCCCCTTTCCGCGCCACTGGTGAATAGGGATTGATGAATGGGAAGAGCTGAGTCAGACCAGTAAGCCCATTGTGGGTTTTTTGAATATGTTCCCATGTAGGAGGTAAAAACCAGTTCTGGAAGTGTCTGTGAGCTTCCATAAATAACTTTTAATTTTAGCATAATAATGGCCTTGGATTATCTGACCTCAGTAGCTGTTAAATAACATCTGTATCAGGCCATACATAGAACGTACAGTTGAGTGGGAGTAAACAAAATAAAAAGACAAACGTGTGTTAATATCTATGCGAGAAAAATCGGGATAAAAGCCTAAACAGGAACAACTTCCTAGCATTGATGCTGGATAAGCAGATGGTGATGGCAAAAGTTTAGAACACATTTTTTTCAAAGACTAAATCTAAAATGCAGAGTAAACATCTATGCTCAGAGTTAGCATAATTTGGAGCTATTCAGGAATTGCAGAGAAGTGCATTTTCACAAAAATCAAGATGTTATTTTTGTATACTATATCACTTAGACAACTGTTTCATTTGCTGTAATCAGTTTTTTAAAGTCAGATGGAAAAAGCAACTGAAGTCCTAGAAAATAGAAATGTAATTTTAAACTATCCAATAAAGCTGGAGGAGGAAGGGGAGTTTGACTAAAGTTCTTTTTGTTTGTTTTAAATTTTCATTGATGTATATAGTGCAAAATGCCATATTAAAGAGGGGAATGTGGAGTACTGAAA