Transcript asmbl_16117

Sequence
Transcript Sequence for observation asmbl_16117 of TGE0018079:
CCGCATGGTAACTCAAGTTCCCTGCGTGCGGTACTCGCTCCTACTTTTCCACGCAGGTCTTGGCTCCCGACTTCTGCAAGATGAAGATTGAGGAGGTGAAGAGCACCACGAAGACACAGCGCATCGCCTCCCATAGCCATGTGAAGGGGCTAGGGCTGGACGAGAGCGGTCTGGCCAAGCAGGCAGCCTCGGGGCTCGTGGGCCAGGAGAACGCACGAGAGGCATGTGGTGTGATAGTAGAATTAATCAAAAGCAAGAAAATGGCTGGAAGAGCTGTCTTGTTGGCAGGACCTCCTGGAACTGGCAAGACAGCTCTAGCTCTGGCTATTGCTCAGGAGCTAGGTAGTAAGGTGCCTTTTTGCCCCATGGTGGGGAGTGAAGTTTATTCTACAGAGATAAAGAAGACAGAAGTGCTGATGGAGAACTTCCGCAGGGCCATCGGGCTGCGGATAAAGGAAACCAAGGAGGTTTATGAAGGCGAAGTCACAGAGCTAACTCCGTGTGAGACAGAGAATCCCATGGGGGGGTATGGCAAAACCATTAGCCATGTAATTATAGGACTCAAAACAGCCAAAGGAACCAAACAATTGAAACTGGACCCCAGCATTTTTGAAAGTTTGCAAAAAGAACGAGTGGAGGCTGGAGATGTGATTTACATTGAAGCCAACAGTGGAGCCGTGAAGAGGCAGGGCAGATGTGATACTTATGCCACAGAATTTGACCTTGAAGCTGAAGAGTATGTCCCCTTGCCAAAGGGAGATGTGCACAAGAAGAAAGAAATCATCCAGGATGTGACCTTGCATGACCTGGATGTGGCCAATGCCCGGCCCCAGGTACTGCTTTGACGCCAGCACTACCTGGCACACAAACCCTTT