Transcript asmbl_15949

Sequence
Transcript Sequence for observation asmbl_15949 of TGE0018076:
TCCGCCTCCTCCGCCGCTCCCTTTGCTGCCGCTTTAGCCTGGGACCCGGACCCAGCCTCTCCCCCACTCGAACGTCGGCCCCGGCTCTGCCGAGGTCCCGGTCCCCCAACCCCGCCTCGCCGCCGCCATGGCGGACCCTAAATACGCTGACCTTCCCGGCATTGCCAGGAACGAGCCAGATGTTTATGAAACCAGCGACCTACCTGAGGATGACCAAGCGGAGTTTGATGCGGAGGAGCTGACAAGCACAAGTGTGGAACACATCATTGTCAATCCCAATGCTGCCTATGACAAGTTCAAAGACAAGAGAGTGGGGACAAAGGGACTTGATTTCTCAGATCGAATTGGAAAAACCAAGAGGACAGGATATGAATCTGGAGAATATGAGATGCTTGGAGAGGGTCTGGGAGTGAAAGAGACACCCCAGCAAAAGTATCAGCGACTCCTGCATGAGGTCCAAGAGCTGACAAGTGAAGTCGAGAAAATCAAGACAGCAGTGAAGGAGTCAGCCACTGAGGAGAAGCTGACCCCCGTGGTGCTGGCTAAACAGCTGGCAGCCCTGAAGCAGCAGCTGCTTGCTTCCCACCTGGAGAAGCTACTGGGACCAGATGCAGCGATCAACCTTACTGACCCTGATGGAGCTCTGGCTAAGCGTCTGCTGCTGCAGCTGGAAGCAACAAAGAACAGCAAAGGGGCTGGTTCAGGGGGAAAGACCACAAGTGGGACCTTCCCAGATGGCAGCCTAGTCACTTATGAACTGCATTCTCGGCCTGAGCAGGACAAGTTCTCTCAAGCTGCCAAAGTTGCAGAACTTGAGAGGCGCCTGACAGAGCTGGAAGCAACTGTACGCTGTGATCAAGATGCCCAGAATCCCCTCTCTGCAGGTCTACAGGGAGCCTGCCTTACGGAAACTGTAGAGCTGTTGCAGGCAAAAGTGAGCTCCCTGGACCTTGCAGTTTTGGACCAAGTGGAGGCTCGGCTACAGAGTGTCCTGGGAAAGATGAATGAGATTGCCAAGCATAAAGCTTCTGTAGAGGATGCAGATACACAGAGCAAGGTGCACCAGCTATATGAAACCATACAGCGTTGGAGCCCCATCGCCTCCACCCTTCCTGAGCTGGTGCAGAGACTTGTCACCATCAAGCAGCTACATGAGCAAGCCATGCAGTTCAGTCA