Transcript asmbl_15768

Sequence
Transcript Sequence for observation asmbl_15768 of TGE0003870:
CGGCAACATTGTTTCAAGTTGGACAAATTGACAAGAGCGAGAGATACACTGAGTTCCATCCGGACCTGGAGACGCGGTTCTGGGCCCTGTTTTCCCCTCCTCCGCCCCCGAGAGCCGGGGCCCGCTTTTTGCAGGGTTCCCAGGCCCCCGCTCCAGGGCCGGGCTGACCCGACTCACTAGCGCTTCATGGAGAACTTTCAAAAAGTGGAAAAGATCGGAGAGGGCACGTACGGAGTTGTGTACAAAGCCAAAAACAAGCTGACTGGAGAAGTGGTGGCGCTTAAAAAAATCCGCCTGGACACTGAGACAGAGGGTGTACCCAGTACTGCCATACGAGAGATCTCTCTACTTAAGGAACTTAACCACCCTAATATTGTCAAGTTGCTGGATGTCATCCACACAGAAAACAAACTCTACTTGGTTTTTGAGTTTCTGCACCAGGATCTCAAGAAATTTATGGATGCCTCTGCTCTTACTGGTATCCCTCTTCCCCTCATCAAGGTAATCTTTCTCATCAACTCTTCCCCAACATGGGCATGTCTTGGGGGAACCGAAGGCAGGCAATTCAGACTGAATGATGATTTGTGACCTTGGTTTCCTTCTCAGCTCTCTTCTTCCTATATATACACACA