Transcript asmbl_15018

Sequence
Transcript Sequence for observation asmbl_15018 of TGE0003840:
AAGCTGGTTCCATGCTCCCCTGTCTGAGCAGGTATCACAGATGGAGGTTGACCCTGTGAAGAGATGTCTGAGTCAGGAATGGCTCCTGTCTCCTGGATCTCTGGAGTGATGCTCTCTCCCACAGTGGGGTGCATGCTGGTACATGAACCTCCTTGCAGGGAGGGAAGTTCCAGGTTCTTTCCTGGCCCTCCAGGTGCTGCTGAGAGGCCTTGCTCTCCCCGGCCTAATTGTGACCCCGACCAATGTCTTCTCCATGCCCCATTCTGGGATCCAGGCTTTCCACCTGTTTTTGCCCTTTCCCCTCATTACCGTCACAACCTACCTGTTTTGTGTCACAGATTCCCTGATATCTGAGTCATCCAATAAACTGCTAGTGGGACAGGGTCATGAACAGACAGAGCCTCTCAGCTCACCAGTCTTCCTATGGAGGCTCCTTTAATATGCACACATATAGAATTTTAGATGTGTAATCGAAATTGTTCATATATACCCACGCAGCTTCAATTATATTTTCATTTACAATTTAAACAACTTCAGAACACTGAGAGTACCATGGTTAGCCAAACCAACCTATTTCCACGTTTTAAATTAACACCTTTTGTTTTGCCTATGGAAATATAGGATGCCATAAATATTGCTGGTAATTCGACTAGGACCTGCTCCCCTCCTCCCCCGCCTCCAGTTCCTCACTCTGAGGCAAGGTTGCTAGGTTGCTACAGGCACGAGGACATGAAGGCAGGGATGCAGGGAACCCGAGAAGCTCTGCTGAGCCCCATGAGTCATGCATACGTGTCACCAGGTCGCCTCTTCAAGAAAAGTGCAGATCTTATATTGAACGTGAAGCTGACTAACTTTGAAGCGGTGGTCTTGCGAACACAGACCAGGACGCCGCAGGTTCTTTCTCCGCTGCCACCGCTCGCAAAGCTTTCCCGACCGACATGCCGTTCGTTGAGCTGGACACGAACTTGCCCGCCAACCGCGTGCCCGCGGGGCTGGAGAAGCGGCTTTGCGCAGCCAGCGCCGCCATCCTAGGCAAACCCGAGGACCGCATGAACGTGACGGTGCGTCCGGGCCTGGCTATGGCGGTGAGCGGCTCGGCCGAACCCTGTGCTCAGCTACTTGTCTCCTCTATCGGTGTAGTGGGCACTGCCGAGGATAACCGCGGCCACAGCGCCCGCCTCTTTGAGTTCCTCACCAAGGAGCTGGGACTAGGCCAGGAACGGATAATTATCCGCTTTTTCCCCCTGGAGCCCTGGCAGATTGGCAAGAATGGGACAGTCGTGACATTTTTATGATTGGCATGGAAGACATCCGGGGTATCTGTGAGCTGGCCACCTCTTCCAGAGAGGCCTCCTGGCATAGTGAAGGCCTGGTTGATCCCAGCTTCTGGCATCCCCACATGCAGATATGTCTGTGACCTCACAGTCCTCTTCATCTCCATCCTTATTCCAAATAAATGAAGAGAGCTTTGTCTTTCAAACATTA