Transcript asmbl_14976

Sequence
Transcript Sequence for observation asmbl_14976 of TGE0003834:
GGTGGGAGGCGGCACCCGTGGCTGTGAAGGAGGCCTGAGAGCGACATGTCCCCGGCGGCTGAGGCAGAGCGGCCCGTGGCGCTGTTTGTCTGAGTCCAGGGCGGCCTGGCGGCCGGCTGAGGAAGAGGGTCGGCGGAGGCTGCCCCCGCTGTAGTGGCCGCCATGCTGGGGGCCCGGGCAGCTGAGGGAGTCGCCGTGGCGCTTCTGAGGCTGCTGCTGCTGCTGCTGCTGTCGGCGCTCCGGGGGCCGGGGCTCGGCGTGGTCGGCACGGCGGGGGCTGGGCTGTCGGACAGCGTTATTTGGGCGGTCAACGCGGGCGGCGAGGCGCATGTGGACGTGCACGGGATTCACTTCCGCAAGGACCCTTTGGAAGGCCGGGTGGGCCGAGCCTCTGACTATGGCATGAAACTGCCAATCCTGCGTTCCAACCCTGAGGACCAGATCCTATATCAAACAGAGCGGTACAATGAGGAGACCTTTGGCTACGAAGTGCCCATCAAAGATGAGGGAGACTATGTGTTGGTGTTGAAATTTGCCGAGGTCTACTTTGCACAGTCCCAGCAGAAGGTATTTGATGTGCGATTGAATGGCCACGTGGTGGTGAAGGACTTGGATATCTTTGATCGAGTTGGGCACAGCACAGCTCATGATGAAATCATCCCTATGAGCATCAGAAAGGGGAAGCTGAGCGTCCTAGGGGAGGTGTCCACCTTCACAGGGAAACTCTACATTGAGTTCGTCAAGGGTTACTATGACAATCCCAAAGTATGTGCACTCTACATCATGGCTGGGACAGTGGATGATGTACCAAAGCTGCAGCCTCATCCAGGATTGGAGAAGAAAGAAGAGGAAGAAGAAGAAGAAGAATACGATGAAGGGTCTAATCTCAAAAGACAGACCAATAAGAACCGGGTGCAGTCAGGCCCCCGCACACCCAACCCCTATGCCTCGGACAACAGCAGCCTCATGTTCCCCATCCTGGTGGCCTTCGGAGTCTTCATTCCAACCCTCTTCTGCCTCTGCCGGTTGTGAGGACAAATTACCATCCTGAACAGGGTGGAGGGTGTGGGAAAGAAACCAAACGTGTTGGTTTGGTTTCTGTATTTTTCATGGTGATTA