Transcript asmbl_14905

Sequence
Transcript Sequence for observation asmbl_14905 of TGE0018035:
GCGGCAGAGTGGCAGGTGAGGCCCTCCGGGACCTGGTGGTGAGGAAGCCCGAGCAGCGGGACCGGAGAACGGACGGCGCCGGGGTGAAGCTCAGAGTGAAGCCTGACTGGAGCCCCGGCAGCAGGCCCCCCGGGATGCTCTGGGCATGGCCTCTAGAGCCCCACAGCAGAGCAGCCAGATGGCAGAGGAGACCCCTGGCTTCCTGGATGCCCTCCTCCGCGACTTCCCAGCCCCGCTGAACCTGGAGAGCCCTTTGCCGTGGAAGGTCCCAGGGACAGTGCTGAGCCAAGAGGAAGTAGAGGGCGAGCTGATCGAGCTGGCGATGGGCTTCCTGAGCAGCAGTGCTGGATGCCAAGGGCCTGGCGCGGAGCTTCTTTAACCAGCTCTGGGAAGTGTGCAGCCAGTGGCAGAAGCAGGTGCCCTTGGCTGCCCGAGTGCCACAGCGGCAGTGGCTGGTCTCCATCCACGCCATCCGGAACACTCGCCGCAAGATGGAGGACCGGCACGTGTGCCTTCCCACCTTCAACCAGCTCTTCGGCTTGTCCGACCCTGTGGACCGCGCCTACTTTGCCGTGTTTGACGGTCATGGAGGTGTGGACGCTGCGAGGTATGCCGCTGTGCACGTACACGCCAACACTGCCCGCCAGCCAGAGCTGCCCACAGACCCCGCGGGAGCCCTCAGAGAAGCCTTCCGGCGCACCGATGAGATGTTCCTCTGGAAAGCCAAGCGAGAGCGGCTGCAGAGTGGCAGCACAGGTGTGTGCGCACTCATCGCGGGAAAGACGCTGCACATCGCCTGGCTCGGGGACTCCCAGGTCATCTTGGTGCAGCAGGGGCAGGTGGTGAAGCTGATGGAGCCTCACAAACCTGAGCGACAGGACGAGAAGGAGCGCATTGAAGCGCTGGGTGGCTTCGTGTCTCATATGGACTGCTGGAGAGTCAACGGGACCCTAGCTGTCTCCAGAGCCATAGGGGATGTCTTCCAGAAGCCCTACGTGTCTGGGGAGGCAGACTCAGCCTCCCGGGAGCTGACCGGCTCCGAGGACTACCTGCTGCTGGCCTGTGATGGTTTCTTCGATGTTGTCCCCCACCAGGAGGTGGCTGGCCTTGTCCAGAGCCACCTGGTCAGGCAGCAGGGCAGTGGGCTGCATGTCGCCGAGTTGCTGGTGGCTGCAGCCCGGGAGCGAGGCTCCCATGACAACATCACAGTCATGGTAGTCTTCCTCAGGGATCCCCAACAGCTGCTGGAGAGTGGGGCCCAGGGAGCAGGGGACTCCCCAGTAGATGGGAGAAGCCGAGGCTTGCCCTCTGACCTCTCAGAGCCAATGAACCAAACTCCACGGAGAAGCTAGGAGGTCTAGGCCCCCGGCCCCCACCCTGCGACCCTCCCCTTCAGATGCCTTAGGACCCGACAGGCAGCGGTGGGCAGGCAGGTGCGGCCCGAGCAGCACTTTCCCCTGGGACCCCTGAGCGCCTTGTGCTGCTTACGTCAGCCCACCCTGGTGGCTGCAGAACTACATTGGGCAGTGGGTGCCACACCTTGCCTGTAACAGGCAGTTCGGATAGCTGGGTGCTCTGAAGGAAGCCTCACCAAAGAGAAGATGACTTGGAAACTGGACTGGCTCTTGCTCCCACGGGCACTGGCTACAGCCAGACCAAAGATGGTGGCCATGTGCATGGGGCAGCAGGACAGACCTAGGAGCCACGGCATTTGCAGGCACGTCCTGGGCACCCAGCACAGGTTTCTCATCTATTCCTCACAGGCCACATCTGGAAGGGCTCTTAGCCACAGATGTGCCTCAAGGGGCCTGGCTGGCTGAGTCCACTTCCCATAGAGGAGAGAGAATCTGAGATCTGGCCCGCAGAGGTCACCTGCCTGCTTCATGGCAGCTGTGACACGTGTGGCCCTGGCCTCCCTGGACCCTTGTCCCCCAAGTACCCAGGGAGAGGAAGCTCAGAGGCACCACGCTTGTCTTTTGTTTGTGGTCTTTTTTTTTTCCCAGGGAAAAGTCTAATTCAGAAGCAGTATTTCAGGTTTTGTCTTTGTTCTGTCAGTGCCAAGGTGACCTGTTGTGTCATATAACTTAAGCAGAGCTTAGCATTTATTTTATTTCTTAGAAAACTTAAGTATTGATTTTTTTTTAATGGGAAACTTCTTTTGCAGTATTACTAAGTTTTTTTTCCTTAAGATTGAAACAAAAACCTTTTCAGGTAGTGTTAATAAGCCGTTCAAGTGCCTTACACAGCTTTAGAGAAGGCTAGATCAGCCAGGCATATAATGGGTTCTAATAGGCATGTTTAAGTTTTCACAAAAGCAAGATTTATTTTGTTGCAGTGGCATGACTCCGGCTAGAATTCTTCCTAGAAGAGTATTTTCTGTCTCTTTGTGATGCGCTGCTGACAGTTAGCAGAGTGGCCCCTGAGAGCATGGACTGTGCTGTGTGGCCCGACCTCACGGCTCTCGGAGCTCAGGGTGACTGTGGCACCTGCCGCCTTGCCACCCACCTTGACCCTGCTGCTTGGTATCTGGCTGGACCTCAGGGCGAGGGCCCAAGCTCTGTGAGCAGACAGGTCCTTGCTGCTGTTTAGAATGTTCCAGAATGTCTTGTGTGTTGGTAGTTGAATTGGTTTCATTGGGAAACACATAAGAGGCTCTGGCAAGCCCAGTGTAGCTTGTGGGTCTGTTTGGAGGCAGCGAGGATGCGACTGGGAGTCTCTCCCACCCACTGGGCTGCAGCCCCTCATTCTGCCCATGGCTGGCGGCCTCCGATGCCTCGTTCTGCCCCTAGCCTGAAAGCTTGTGAAAGAGCTTGTGTCCCCTCCTGCCCTGGGAAGGTGAAGCTCAGGTGACTTCATTTGCTCATATCAAGTGGGGCAGATAAAAATCCCATGTGGAGTTGGCTAGACAAGGGCTCTAGGTAGAAGTTAAGCCCTGGGGTAGGTCAGGTCTCTGGTAGGAGCCCCGGGGCTCGCAGTGGTGGGCAATGTTGCTGTAGGCAGAGGCTGGCAGGTCTGAGAAGGGAGTAGCTGCAGGATAATGTCTGGGGGTGTGGGGCTGGGCAGTGGGAGGAAGCTTAGTGCGAGGTCCTATGGAGATATTCAGAGTCCACTCACAATAGCAGGGCCCCAGGAAAGCCTGCACAGGGAGCCCCCTGATCCCAGTGGCACTGAGAGGAGCCCCGGGAAAGGAGTGGCTGGTAAAATCCACCTCTCCTGAGGCTGGTGGGCTGTCCAGCAGGAAGGGAGGGAGCCATGGGCCACCACTTGTAGGCTCCACATTAACCCCACTCCCACAGCAGGATGAAGATGCTGAGGCCATGTGGTCAATGCCTTTCTCAAGACCTCATGATAAAAAGCGTCTTAAACATGGTCACTGTAATTTAGAGAATGTTTGGCGGCCAACATGTCCAGGTGTTACCCCATTTCACTTCAAGGCCCTGCTGCCTTCTGGGGGCCAGAGGCCCTTCTCATCGCCCCCACCCTTCTCTACCATGGGCATGACCTTAGTGGAGGGAGGGAGCAACAGGCTTCTGTTTTTCTCTTTTCTTTGCTAATCTTATTCTGTTGATTGCTACCAAGAGAGGAGCTTCACCTTGTGGAGTCTGGATCACACCACTTGGTGACCTGATTCATGCCCCGGCCCAAGGCTCCACCAGGATATCTCTCCAGGTTTGTCTTGGCATCTCCCCCACCCCCAGCCAAGGTCAAAGCCCCCTCCCCCTCCACAGCAGAGGCCTTTGCTGTCTGGTGTGACCCTGGCAGCTGAGGGAACCTTTGTTCTCCTGCTGCACTGGGTCCGGCCTGTGTAAGCACCAAGGCACAGAGTCAGTCTCTTCCATCCTGACTTGGCTGCACTGAGAGCCTTGGGCAGTCTTCAGCCTCCCAGCATTCTGGTCCATGTCCTCCTCAGGCCACAGTCCCAACAGGGCCCCTAGCTGGGACGCTGGTCTGGACACCTCAGTCCCCTTCTCGAGTCCCAGGTCTGCCACTAGCTCATTAGTGAGCTGAATAAGTTGTCACCCCTCCCTGTGCCTCATTTTCCACTTTGTAGGGCACAGGGTTACACTGAGTCTGTGTAGTAGCTTCTGGAAATCTGGTGCAGAGGTCACTTGGGGCAAATCCAGCCACATCCTGGGGTGATGCTACCAGTGCTGCGGGCTCATCCCGCACCACCAACGGGGAGGGGTGATTAAGTATTATTAGTGTCTATTCTTAAAATTAAGTGGGTTGGAAAAGAATCAAGCTACTAATGCTAGCGCCTTATATGGAATACAAAAGCTGGAGAAATCCAACCCTGCTTTTACAGGTAGGGCTGATACCCAGCCAGCAGGGGTGGGAGAGGCGCAGGCAGCCACTGGAAGAGGGGCTGGCATAGCTGGGGTGGTTAGTCAAGATCCCAACCCGCTGAAATCCTGGAGGTGAATGAATGCATGGGCTCCTGACACAGCCCATCCTCAGCATCCAGGACTAGGAAATGGCTGTGTCTTAGGGAGAGAGCAATAGGGGTGGGCCCCAGAGAGGAGCACAGGCTCTCTGAGGTCCTGGGTCAGCTTTGGACCAGCCCTGCCTTTGGCAGCAGTCCTGTCCCCTTCCACCCTCCCCAGGCCAGCACGTAGTCCCTGGCCTCACTCCTTCCCCAGCTACTTCAGCAGTATTCCTGGGGCCAAGGGCACAGTTCTGACAGCTCATAAGCCTGGCCCCCGTCCCAGCTAAACTGAAACCAGGTGGGTCTGTGTAAAATAAGCTCTTTTGATTTGATTCTGGCCGTTGTCCAAAGGGAGCAGCCCCAGGGGCTTGCACTTTTCCAAGGCTCCACAGCTTTGCCAAATTTGCCAAGCTTGCCATTCACATGCCGTGCTGGCCTTGCCAAGGGTTTATCTGTGTACTTCTCAGTGGGGTTCCTGGGAGTGATGTTCTGTGATGGGGGGTCTTGTTCCAAGACAGGATGGCTGTTTTTCCATGTCTGTAGGGACAAGTCCTAGGGTGAAAGGCCAGAAAGGCGTTCTCCTCCCAGGGCCTTTATGCTCAAGTGTCAATAAATCCTGAGTTTTGAAACCTGT