Transcript asmbl_12959

Sequence
Transcript Sequence for observation asmbl_12959 of TGE0017968:
CCCCTCGCTTGGGTGTGTCCTTAGCTAGCTCCCTCCCTCTCTCTCTTAGGTCATTTCTGAATAAAAACTGCAGCCAACTTCCGAGGCGCCCTCATTGCCCAGCTGGACCCCAGCCTCTGTCAGGTTCCGGCTGCCCTCCTCGCCCCGTCCTCCGCCCGCCCCCCACTCAACGCACGAGGACCCTCCACCTCCACTCGCTTGCTCCCGTGGTCCGCTGTAATACCATGGGCAAATTTGGGTGGCGCGCAGTCTGGGGACTCTGCCTTGTGCAGCTGAGCCTGGCGCAAATCGGATTTGAATATATGAACAAGAGGGAATGAGAAAGGGGTGTGTGTATTTGTCAGAAAACAAATGTTGCAAGGCTAGACCTGAGCATTTCCTGATTGCCATGGCAACACGCAAGGATACATCCTGAGGTTTCTCTCCCTCAGTACGGGTTCATAGAAGGGCACGTAGTGATCCCCCGCATCAACCCTAACTCCATCTGTGCCGCAAACAACACAGGGGTGTACATCCTCACCTCCAACACTTCCCAGTATGACACGTACTGCTTCAATGCTTCAGCTCCGCCCGAAGAAGATTGTACATCAGTCACAGACCTGCCCAATGCCTTTGACGGACCAATTACCATAACTATCGTCAACCGTGATGGCACCCGCTACACCAAGAAAGGTGAATACAGAACTAACCCCGCAGACATCAACTCTAACTCTAGCAACTCCACTGAGGACGATATGAGCAGTGGATTCTCCAGTGAAAGAAGTACTTCAGGAGGTTACAGCATCTTCCACACCCACCTTCCAACTGCATACCCAACCCAAGACCAAGACAGTTTCTGGGTGTCCGACAATCCAGAGGAAGCCCCTACTACCAGTACGGATTCAAATATCATCTCAGCAGGCTGGGAGCCAACTGAAGAAAATGAAGATGAAAGAGACAAACACCCCAGTTATTCTGGATCAGGCATTGATGATGATGAAGATTTTGTCTCCAACACCACAGACGTAGACAGAAGTGGCATCAGTGATTATGGAGAAAACTGGACCCAGGAACCACACTCTCCTCTCATTCACCATGAGCATCATGAGGAAGAGGAGACCCAGCATTCTACAAGCACAACCCGGGCAACTTCTAATAGTGCAATGGAAGAAACTGCCACCCAGAAAGAACAATGGTTTGAGAACGGATGGCATGGGGTATATCCCCAAACGCCCAGAGAAGACTCTCATTCAACAGCAGGGACAGCTGCCTCAACCCATGACAACCATCCAAATCAAAGAATGACAACGCAGAGTCAAGAGGACAGTTCCTGGACTTATTTCTTCGATCCAATCTCACACCCAATGGGACGAGGTCATCAAACAGAAAAAAGAATGGATCTGGACTCCAGCCATAGTACAACACTTCAGCCTTCCACAGATTCAAACACAGGTTTGGTAGAAGACTTGGACATGATGGGACCTCTTTCAATGACAACTCAGTGGAGTCATACTCAGAGGTTCTTTACATCACATGGAGGCTTGGAAGAAGATAAAGACCATCCAATGACTTCTACTCCAACATCTAGCAACAGGAATGATGGCACAGGTGAAAATCCTCCTGAAGACTCAACTACTTCAGTAGAAGGTTATGCTCCTCATTTCCCAGACTCAGAGGGGTACAGGACCCCCACCCCAGTGACCCCTGCTAACACTGGGTCTCCTGAAGTTACTGAAGTCACTGTTGTTGGAAATTCCAATTCTGATGTTGATGGTTCCTTACCAGAAGACCAAGGCTCATCCCATGACCCCAGCGGGAGGGCCCATACCACTCATGGATCTGAATCAGCTGGACATTCAAGTGAGAATCGAGAAGGCGGGGCCAACACGACCTCTGGTCCTATAAGGAAACCTCAAATCCCAGAATGGCTGATCATCCTGTCATCCCTCCTGGCCCTGGCTTTGATTCTCGCAGTTTGCATCGCGGTCAACAGTCGAAGGAGGTGTGGGCAGAAGAAAAAGTTGGTGATCAACAATGGAAATGGAGCTGTGGAGGAGAGGAAGGCAAGTGGACTCAATGGGGAGGCCAGCAAGTCTCAGGAGATGGTGCATTTGGTGAACAAGGAGTCAACAGAGACCCCGGACCAGTTTATGACAGCCGATGAGACGCGGAACCTGCAGAATGTGGACATGAAGATTGGGGTGTAACACCTACACCGTGACCTTGGAAAAAAATGACACGTAACCATTACAGGGAGCTGGGACACTTCACAGATGCAATGTGCTACTGATAATTTCATTGGGGTTCTTTTTTAGCATAAAATTTTCTACTCCTTTTTGTTTTTTTGTGTTTTGTTTCTTAAAGGCAGTCCAGTTTATAAAAACAGCATTGCTTTCTGAAACGAGGGCCCAATTAACAATCGGTAAGAATTTGACTGTTCCAGTTCCCACCTAGAAGCCTCTCACTCCCTGGGGTGTGCTATAGATGACTTCTAACAAAACCCAACAAATCCATCTTCCCAGTTGACTCCCAACCTTCCTTCCACCCCACCTCCCAGGGGACAGCCACATGCTAAGGACATCTCCAAGGCTAAGAGGGATTGGTTCCTGGGAGGAAATTTGGATGGGTTCATTTTGCCCCTCCAGCGGCCCAATCCCTGGGCGTTGCTTTCCAGCGGGTATAGGGGATCGGGTGTACTGGTTATACATCCCTTTCCACAGATCCCCTGGAAATTTTTCAGATGCTTCTGGGAAATGCCCAAAGGGTGAAGCTATTTATCTGTAGTAAGCTATTTATCTGTGTTTTTGAATTGTTAAACCCTGGAGGTCCTTTGATCAGTATGATCTTTTTTTGTTTTGTTTTGTTACTTTGTCAGAGGCACAAAGGGGTTTAAGCTGATTCGTAATAAACATCTGTATTTCTTCTACTTTAA