Transcript asmbl_12775

Sequence
Transcript Sequence for observation asmbl_12775 of TGE0003105:
GCCATTTGCTTCACTCGGAGGTAGATTCTTGCTAATTGTCCTAGAGTCCGTATTAATATCGTTCCGGGTCTGCGATCTGTAATTCCTTTATCTCACTGGCCTCTCGGAGAAGTCGCCGTTGCGAAGGCACCACCAGATAAGAGTAGGAGACGCCATGCCCAAGAATAAAGGTAAAGGAGGTAAAAACAGGCGTAGAGGTAAGAATGAGAATGAATCTGAAAAAAGAGAATTGGTCTTTAAAGAGGATGGGCAAGAGTATGCTCAAGTAATCAAAATGTTGGGAAATGGACGATTAGAAGCAATGTGCTTCGATGGTGTAAAGAGGTTATGTCATATCAGAGGAAAATTGAGAAAAAAGGTTTGGATAAATACCTCAGACATTATATTGGTTGGTCTACGAGATTATCAGGATAACAAAGCGGATGTAATTTTAAAATATAATGCAGATGAAGCTAGAAGTCTGAAGGCATATGGCGAGCTTCCAGAACATGCTAAAATCAATGAAACAGATACATTCGGTCCTGGAGATGATGATGAAATTCAGTTTGATGATATTGGAGATGATGATGAAGACATTGATGATATCTAAATTGAACTCAAAGTTTCTGAGTATTGCTCTACGATTTGGATTTTGGCCATCACCTGTTAAGAAGACCAAAACTTCATTAAACATGAATGCAGTTTGTTAGGACACACTGATTTATTTCATTGTTTAAAGTATTTATTATATTTCTTTAAAAACCGCCAAAGCTGAATTATCTTAAGTGAAATGTTAACAATTTATTCTTTTGATGTAATAGAACTTAGTGGTAGACCACAGTATCTGTTATTTAAAATAGTAGGAGAAAGTATATTAATAAAAGAAGGCTTTAATGGATATTTTTAATAAATTGCTTTATCATAGACTGCGTTAAGCCCTAGGGCCAACTAGTCTGTTTAGAAACTCTTTCTATATGTTCCAGTTACCTAGATGTTCTCTTGAGATTTTAGTTTAAATTTAAGGAAGGCAGAAATCTACATCTGAAGTCAAGAAAAGGGGCTATTTTCATATTTATGTAGCTGTATGTATTTTTATACTGTTTGATAACATTCTTTTCATCATTTTATGTTGTCACCATCAAAAAAAGCATTTCAAAATACAGCTTTTAGAACATGAGTTTGAGTAGTAATTTTGAATTTGTAAGATTTGTAGTGGCAAAAATTCAATGCTAATAATTAATGCCCAATTATCTTAATATTGGAAATATTGATATATTAGTTGATAGTGTTTTTCACTTAATATGTGGAAATTTTCTTAAGTAAGACAACTTTTAATGGCAACTTTTAGTGGAATAATTTTTACTATAAAAAAATGTTATGTTAAAATATGTCATTTTATTGTCAAAAGTCATCTGTATTTGTAACCTATAGTTTTG