Transcript asmbl_12009

Sequence
Transcript Sequence for observation asmbl_12009 of TGE0003671:
GGACCGGGGGTAAGGGCGCCCCGACTCTCGTTAGCGGGTCGCGTGCTGATAGCACGGGTGCGGCCCTTATCAGCCAGCACCGGCTCCTCCCTCGCTTTCTCTCGGCCCCCTCCTGGGTGGGCCCTGCGCCCCGGGTGCCCCGAAAGCAGTCAGCGGCCGGGGCTGGAGCGCGCATCCCGCGCAGCTTCCGGAGAGAGGGATCCCCTGGCCAGCCTGTCCGCGTCGCCGCTCTCCCCCAGGTCCCAATGGGCCGGACCGTGGTCGTGCTGGGCGGAGGCATCAGCGGCTTGGCCGCCAGTTACTACCTGAGCCGGGCCCCCTGTCCCCCCAAGGTGGTCCTGGTGGAGGGCAGCGAGCATCTGGGAGGCTGGATCCGCTCCTTGCGCGGCCCAGACGGCGCTGTCTTTGAACTTGGACCTCGAGGAATTCGGCCAGCAGGAGCGCTGGGCGCTCGGACCCTGCTCCTGGTGTCTGAGCTCGGCCTGGACTCCGAAGTGCTGCCCGTCCGGGGGGACCACCCTGCGGCCCGGAACCGGTTCCTGTACGTGGGCGGCGCCCTGCACGCGCTGCCCTCCGGCTTCAGGGGGCTACTCCGCCCTGTGCCTCCCTTCTCCAAACCTCTGTTTTGGGCTGGGCTGAAGGAGCTGACTGCACCCCGGGGCAAAGACCCTGACGAGACTGTGCACAGTTTTGCTGAGCGCCGCCTTGGACCTGAGGTGGCGTCTCTCGCCATGGACAGCCTCTGCCGTGGAGTATTTGCAGGCGACAGCCGGGAGCTCAGCATCCGCTCTTGCTTTCCCAGTCTCTTCCAGGCGGAGCAAAGCCATGGCTCCGTGTTACTGGGGCTGCTGCTGGGGGCAGGGCGGAGCCCACAGCCCGACTCAGCCATCATTCGCCAGGCCAGAGCTGAGCGCTGGAGCCAGTGGTCACTCCGTGGAGGACTGGAGAGGTTGCCTCAGGCACTTCACAGCCACCTGACTCGTAGGGGGATCAGTGTTCTCAGAGGCCAGCCAGTCTGTGGGCTCAGCCTCCAGGCAGGAGGGCACTGGAAGGTGTCTCTAGCGGACTGCAGCCTGGAGGCTGACCATGTCGTCAGTGCTATTCCAGCTTCAGCGCTCGGCGCGCTGCTGCCTGCCGAGGCCTCACCACTGGCCGAAGTCCTGAGAACCATCCGAGCGGTGTCTGTGGCTGTGGTGAATCTGCAGTACCGCGGAGCTCGTCTGCCTGTCCAGGTGACACCGCGGAAGGGGAGACGCGGGCTCAAGTTCACGCCTCCCGGCTGAACCCATCCCTTCCTTTTGTCCAGGGGTTTGGACACTTGGTGCCGTCCTCGGAAGACCCAGGCGTCCTGGGGATCGTCTACGACTCAGTTGCTTTCCCTGAGCAGGATGGCAGCGCCCCCAGCCTCAGAGTGACTGTGATGCTGGGAGGTTCCTGGTTACAGACGCTCGAACCCGGAGGCTCCGGCCTATCCCGGGACCTGCTCCAACGCCAGGCACAGGAAGCAGCTGCCACACAATTAGGACTGAAGGGGCCACCAAGTCATTGCTTGGTTCATCTACACAGGAACTGCATCCCCCAGTATACACTAGGCCACTGGAAAAAACTGGAGTCAGCCACCCAGTTCCTGGCTGCTCACAGACTGCCCCTGACTCTGGCCGGAGCTTCCTATTGGGGGGTCGCTGTCAATGACTGTATAGAGAGTGGACGCCAGGCAGCAGCCCAGGTCCTGGGCTCAGCACCCCATAGCTGATCCCCACTCCCAGCACCTGCCTGCTGGCGGGGAGTCTCTCACCCATGACAATAAAAGTTGCTGGAGGTTG