Transcript asmbl_11982

Sequence
Transcript Sequence for observation asmbl_11982 of TGE0008082:
AGCTGCAGAAACGGCGCGGCTGTTCCCACAAAGCGTGGCTAGCGGAGCGCCATGAGCAGAGCACCCAGCGATCTCAAGCTCAGGCTGGCCCGGGCTGGGCAGGAGCACCTGCTGCGGTTCTGGGATGAGCTGGAAGAGGCCCAGCGGGCGGAGCTCTGTGCGGAGCTCCAGGCCATGGACTTCGAGGAGCTGAGCATCTTTTTCCAGAAGGCCACCGAAGGAGTCCACCAGTTCTCTCAGCTGGAGAAGGTGGATGCGCGGATGGAGCCTATCCCTCGGGAAGTGCTGGGCAGCGCTACGCGGGATCAAGATCAGCTCCAGGCCTGGGAAAGTGAAGGACTTTTCCAGATTTCTCAGAACAAAGTGGCTGTTCTTCTTCTAGCTGGCGGACAAGGGACAAGACTTGGTGTCTCGTATCCCAAGGGGATGTACGATGTTGGGTTGCCATCTCATAAGACACTTTTTCAGATTCAAGCAGAGCGGATCCTGAAGCTTCAGCAGTTAGCTGAAAAATACCATGGCAACAAGTGCACCATCCCGTGGTATATAATGACGAGCGGCAGAACAGTGGAGTCCACAGAGGAATCCTTCACCAGACACAAGTACTTCGGTTTGAAAAAGGAGAATGTGATCTTTTTTCAGCAGGGAATGCTACCAGCCATGAGTTTTGATGGGAAAATTATTTTGGAAGAGAAGAATAAGGTTTCTATGGCTCCAGATGGAAACGGTGGTCTTTACCGGGCTCTTGCGGCCCAGAACCTCGTGGAGGATATGGAGCAGAGAGGCGTCGAGAGTGTTCACGTGTACTGCGTCGACAACATTCTGGTCAGAGTGGCGGACCCCCGGTTCATCGGATTCTGCATTCACAAGGGAGCAGACTGTGGGGCGAAGGTGGTGGAGAAGACGAACCCCACGGAGCCGGTGGGCGTGGTGTGCCGGGTGGACGGCGTGTACCGCGTGGTGGAGTACAGCGAGATCTCCCTGGCCACCGCGCAGCGGCGGGGCCCCGACGGGCGGCTGCTGTTCAGCGCGGGCAACATCGCCAACCACTTCTTCACCGTGCGGTTCCTGAGAGACGTGGTCAGTGTTTATGAACCTCAGTTGCAGCACCATGTGGCTCAAAAGAAGATTCCATTTGTGGATCCCCAGGGGCAGTTAATTAAGCCAGACAAACCAAATGGAATAAAGATGGAAAAGTTCGTCTTCGACATCTTCCAGTTTGCAAAGAAGTTCGTGGTGTATGAGGTGTTACGGGAAGACGAGTTCTCCCCACTCAAGAACGCGGACAGTCACAGTGGCAAGGACAACCCCACCACGGCCAGGCACGCTCTGCTGTCCCTTCACCACCGCTGGGTGCTCAACGCGGGGGGCCACTTCGTAGACGGAAATGGCTCCCGCCTGCCCGCGATTCCCTGGTAAGCCGGTGCCTTTGTCCCCAGGGGGCCGTGTCC