Transcript asmbl_11967

Sequence
Transcript Sequence for observation asmbl_11967 of TGE0003662:
CAGCCCCGCGGAGGTGACCCAGAAACGTTTGCCAGTTCGTAGTGGAACCTTTAAGTGGGTCGTTTCCTACCTCTGCCTTGGAGCTGGAGACCCCGCAGGGAGCGAGGCGGACTCTTCATTCACGGTCCTGCCTTGAGGTTCTGAGAACTTCCCCCTCTATCTGGTGTCGCTGCCCGGAGCCCGCGGGCCACAGCGAAGGGGCGGCTGCAGGGTGTGGAAGGGACCGGAAGCTCGTTGAGCCAACATGGCCGTCCTCTCCAAGGAGTATGGCTTCGTGGTGCTGACGGGGGCCGCCAGCTTCATCATGGTCGGCCATCTGGCCTTCAATGTGTCCAAGGCCCGCAAGAAGTACAAGGTGGAGTACCCCACCATGTACAGCGCAGACCCCGAGAACGGACACCTGTTCAACTGCATTCAGCGAGCCCACCAGAACACGTTGGAAGCGTATCCGGCCTTCTTGTTTTTTCTAGCTGTTGGGGGTGTTTACCACCCGCGAGTAGCTTCCGGTTTGGGCCTGGCCTGGATTGTCGGACGGGTTCTCTACGCCTACGGCTATTACACAGGAGACCCTAGCAAGCGGAGCCGGGGGGCGCTGGGCTCCGTCGCCCTTCTCGGCTTACTGGGCACCACCGTGGTCTCGGCCTTCCAGCACCTCGGCTGGCTTAGACCTGGCTTGGGCAGTGAGTGCAAATCCTGCCATTAAAGAATGATAGGGTGTCTGAAAACTCTGATTTCGTCCCGAGTGACTTTTATTTCCAGTTACAGTTTTTCTAAATATAATAAAAATTTATCTGGCATCAGCCTCATACGT