Transcript asmbl_11966

Sequence
Transcript Sequence for observation asmbl_11966 of TGE0003662:
CTCCTAGAAACATCGGTTTGCTCACGACTTCGGTCTGCCAGGCACAGCTGCTCCTGCCGCGCGGGGCCACAGGGCCGGGCGGCATCCTCACCTGTCCCTTCCCCCCAGAGCCAACATGGCCGTCCTCTCCAAGGAGTATGGCTTCGTGGTGCTGACGGGGGCCGCCAGCTTCATCATGGTCGGCCATCTGGCCTTCAATGTGTCCAAGGCCCGCAAGAAGTACAAGGTGGAGTACCCCACCATGTACAGCGCAGACCCCGAGAACGGACACCTGTTCAACTGCATTCAGCGAGCCCACCAGAACACGTTGGAAGCGTATCCGGCCTTCTTGTTTTTTCTAGCTGTTGGGGGTGTTTACCACCCGCGAGTAGCTTCCGGTTTGGGCCTGGCCTGGATTGTCGGACGGGTTCTCTACGCCTACGGCTATTACACAGGAGACCCTAGCAAGCGGAGCCGGGGGGCGCTGGGCTCCGTCGCCCTTCTCGGCTTACTGGGCACCACCGTGGTCTCGGCCTTCCAGCACCTCGGCTGGCTTAGACCTGGCTTGGGCAGTGAGTGCAAATCCTGCCATTAAAGAATGATAGGGTGTCTGAAAACTCTGATTTCGTCCCGAGTGACTTTTATTTCCAGTTACAGTTTTTCTAAATATAATAAAAATTTATCTGGCATCAGCCTCATACGT