Transcript asmbl_11923

Sequence
Transcript Sequence for observation asmbl_11923 of TGE0017915:
CCCCCCCAAGCCCGGCAGGAACTTCTCGGGTCCCAGGAGCGACAGGAGAAGCGGCCCGCCCCCCAAGGGCGGGAAGCGCGGGCCGTTTGATGACCAGTCTGCAGGCACAGCGGGCGTCGACCCTCCCAGTGGCAGCTCCGCACACCATCAGGAGGGAGCACCTAATGGGACAGGACAGAAGAACAATAAAGATTCTGCAGGGAAAAAAAGAGAAGACCCCAAGCCAGGCCCTAAGAAACCCAAAGAGAAAGTGGATGCACTGTCACAGTTCGATCTCAACAATTATGCAAGTGTTGTTATAATTGACGACCATCCTGAAGTGACAGTAGTTGAAGACCCACAGTCAAATTTGAATGATGACGGTTTTACTGAAGTGGTATCCAAAAAACAACAGAAGCGTTTACAGGATGAGGAACGCCGGAAGAAGGAAGAACAGATCATACAGGTCTGGAACAAAAAGAATGCGAATGAAAAAGGACGAAGTCAGACTTCTAAGCTTCCTCCAAGATTTGCGAAAAAGCAGGCTACAGGGACCCAGCAAGCACAGTCTCCATCTGCAGCTCTGGCCACAGCTCCAGGTCCAGCCTCAGCCGCAGTCCTAACCTCACCCTCCACGCCACTACCAACGTCAGCCTCGGTGCCAGTGCCAGCTTCCACCTCAGCTACCACCCCCTCTTCTTCAGTTCCAGCTCCAACCCCCATCCTTGCCTCAGCTTCGACCCCAGCCTCTGTCCCCATCCTGACCTCAGCCTCAATTCCCATCCTTGCTTCAGCCCTGGCACCAACTTCAGCTCCAGCTCCAGCCAACTCATCCCCGACCGCCCCAGCCAACTCAACCCCAACTGCCCCAGCCAGTTCAGCCCCAGTCCCAACTCCAGCCTCACTCCCAGCCCAAGCCCCACTCCCAGCCCCGTCTCCAGCCCTAGTCAGTGTCCCAGGTCCCACCGCCTCAGCCCAAACTCAGGGACAGACTCACAAACCAGTCCAGAGTCCACTACAGACTTCAGCACAGCCTCCAAAACAGCCACCACCTTCAATTAGACTACCTTCAGCCCAGACACCTAATGGCACAGATTATGTAGCCACAGGAAAGGCCATCCAGACCTCACAGTCACATGGCACTCTAGCAACTGAACTGTGGGATAACAAGGTGGCCCCACCAACTGTGCTGAATGACATCTCAAAGAAATTAGGTCCCATTAGCCCACCACAGCCGCCTTCGGTCAGTGCCTGGAACAAGCCTCTAACGTCGTTTGGATCAGCTGCTTCATCAGAGGGAACAAAGAATGGTCAAGAAAGTGGAGTTGAAATTGGAATTGACACAATTCAGTTTGGTGCTCCAGCTTCAAACGGGAATGAAAACGAAATTGTTCCTGTGCTTTCAGAAAAAACTACTGACAAAATACCCGAACCTAAAGAACAACGGCAGAAGCAGCCACGGGCAGGCCCTATCAAAGCCCAGAAGCTTCCGGATTTGAGTCCAGTAGAAAACAAAGAGCATAAACCTGGTCCTATTGGAAAGGAACGATCATTAAAAAATAGAAAAGTAAAAGATGCCCAACAAGTGGAACCGGAAGGACAAGAGAAACCAAGCCCCACTGTCGTCAGAAGTGCAGATCCTGTGACAGCAAAGGAAACCAAAGCAGCTTCCGAAATGTCTGCTGAGATAGGAACAATGATCTCGGTGTCATCTGCAGAGTATGGCGCTAACGTGAAGGAGTCTGTAACAGACTATACTACACCTTCCTCTTCTCTGCCTAACACTGTGGCTACTAATAATGCAAAGATGGAGGATTCTTTGGTTAATAATGTGCCCCTGCCCAACACCCTTCCCCTCCCTAAGAGGGAGACTCTACAACAGAGCTCCAGCCTAACTTCAGTTCCTCCCACTACTTTCAGCCTCACCTTCAAGATGGAGTCTGCGCGTAAGGCGTGGGAAAATTCTCCCAACGTGAGGGAGAAGGGCTCTCCGGTGGCCTCTGCAGCGCCCCCCGTCGCCAGCGGCGTCAGCAGCGGCGCCAGCGGCCCGGGCACGGCCAGTTACAGCTCATTCTCCAGC