Transcript asmbl_11568

Sequence
Transcript Sequence for observation asmbl_11568 of TGE0017903:
GCTGGACTAAATACAGTAAAATTCAGCAATTGGGAGAGGCGGGAGCATAATACAGGAGTTAGCTGGAGGGACTAAATCGGGGATCTTGGCTAGGTTTTCTTTCCCGTTACTGACTACCGATCTTGGATTAATGCTTCCATTCCTTTTTGTAGCGTGTGTGAGAATTTTTTTCACAGTAACAAGGAGAAAGGTGTTGGAAGCCATTCAAACTCCTCCCCACGACACTCTGAAGCAGCGACGGCACAGCGGGAAGAATGGAAAATGTTTATAGGAGGCCTTAGCTGGGACACTACAAAGAAAGATCTGAAGGACTACTTCTCCAAATTTGGTGAAGTTGTAGACTGCACTCTGAAGTTAGATCCTATCACAGGGCGATCAAGGGGTTTTGGCTTTGTGCTATTTAAAGAGTCGGAGAGTGTAGATAAGGTCATGGATCAGAAAGAACATAAATTGAATGGGAAAGTGATTGATCCTAAAAGGGCCAAAGCCATGAAAACAAAAGAGCCTGTTAAAAAAATTTTTGTTGGTGGCCTTTCTCCAGATACACCTGAAGAGAAAATAAGAGAGTACTTTGGTGGTTTTGGTGAGGTGGAATCCATAGAGCTCCCCATGGACAACAAGACCAATAAGAGGCGTGGATTCTGCTTTATTACCTTTAAGGAAGAGGAACCAGTAAAGAAGATAATGGAAAAGAAATACCACAATGTCGGTCTTAGTAAATGTGAAATAAAAGTAGCCATGTCGAAGGAACAGTATCAGCAACAGCAACAGTGGGGATCTAGAGGAGGATTTGCAGGAAGAGCTCGTGGAAGAGGTGGTGGCCCCAGTCAAAACTGGAACCAGGGATATAGTAACTATTGGAATCAAGGCTATGGCAACTATGGATATAACAGCCAAGGTTACGGTGGTTATGGAGGATATGACTACACTGGTTACAACAACTACTATGGATATGGTGATTATAGCAACCAGCAGAGTGGTTATGGGAAAGTATCCAGGCGAGGTGGTCATCAAAATAGCTACAAACCATACTAAATTATTCCATTTGCAACTTATCCCCAACAGGTGGTGAAGCAGTATTTTCCAATTTGAAGATTCATTTGAAGGTGGCTCCTGCCACCTGCTAATAGCAGTTCAAACTAAATTTTTTGTATCAAGTCCCCGAATGGAAGTATGACGTTGGGTCCCTCTGAAGTTTAATTCTGAGTTCTCATTAAAAGAAATTTGCTTTCATTGTTTTATTTCTTAATTGCTATGCTTCAGAATCAATTTGTGTTTTATGCCCCTCCTCCCCAGTATTGTAGAGCAAGTCTTGTGTTAAAAGCCCAGTGTGACAGTGTCATGATGTAGTAGTGTCTTACTGGTTTTTTAATAAATCCTTTTGTATAAAAA