Transcript asmbl_11062

Sequence
Transcript Sequence for observation asmbl_11062 of TGE0003604:
CGCGGCATCATGAGCAGCAAAGTCTCTCGCGACACCCTCTATGAGGCTGTGCGGGAAGTCCTGCACGGGAACCAGCGCAAGCGCCGGAAGTTTTTGGAGACGGTGGAGCTGCAGATCAGCTTGAAGAACTATGATCCTCAGAAGGACAAACGCTTCTCTGGCACCGTCAGGTTGGCACCGTTCTGACCCCACCCAGCACTCAGTGCCCCCCGTGCCCTGCTACTCTCTTGAGGCTCCTTTTGAGCCCTTGATGGGCAGGCACGTGCTGCACTGAAGTGCCCGGGTAGTTCAGACCCTCTGCTTTGGGCAGGTGCGGCTGGACGGACCCCCACCCTGGGTCTTAAAACAAGAGGGGAGGCGTGGGGAGGCCTTGGCCGAGCCCGCCGGCTAGTTTGAGAAGCCAGACTAGCTGTTGGTGAATGTGAACGCTCTGGGCTTAAGTCCACTCCCCGCCCAAAGTTCTCTGTATGTGTTCTGGGGGATCAGCAGCACTGCGATGAGGCCAAGGCTGTGGATATTCCCCACATGGATATCGAGGCATTGAAAAAACTCAACAAGAATAAGAAACTGGTCAAGAAGCTAGCCAAGAAGTATGATGCCTTTTTGGCTTCAGAGTCTCTGATCAAGCAGATCCCACGAATCCTGGGCCCAGGCCTGAATAAGGCAGGCAAGTTCCCTTCCTTGTTGACCCACAATGAGAACATGGTGGCCAAAGTCGATGAAGTGAAATCCACAATCAAGTTCCAGATGAAGAAGGTGCTATGTCTAGCAGTGGCCGTTGGCCACGTGAAGATGACAGATGATGAGCTTGTGTATAACATCCACTTAGCTGTCAATTTCTTGGTGTCATTGCTCAAAAAGAACTGGCAGAACGTCCGGGCTTTATACATCAAGAGCACCATGGGCAAGCCCCAGCGCCTGTACTAAGGCACA